EMU171171

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Pdia2

NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGAGATACCCCCTGACTGGGACCAGGGGCCAGTCAAGACTCTCGTGAGCAAGAATTTTGAGCAGGTTGCCTTTGATGAAACCAAGAATGTGTTTGTCAAGTTCTATGCCCCATGGTGCAGCCACTGCAAGGAGATGGCTCCAGCCTGGGAGGCATTGGCAGAGAAGTACAAGGATCGTGAGGACATTGTCATTGCCGAGTTGGATGCTACAGCTAATGAGCTGGAGGCCTTCTCTGTGCTCGGCTATCCCACTCTCAAGTTCTTTCCTGCAGGGCCTGACCGAAAGGTTATAGACTACAAAAGCACTAGGGACCTAGAGACATTCTCCAAGTTCCTGGACAGCGGAGGTCACCTGCCTAAGGAGGAACCCAAGGAGCCTGCAGCCTCTGCCCCAGAAGCACAAGCCAATTCCACCTTGGGTCCCAAGGAGGAGCTGTAGCCATTGGGACACTGTAATCCAGAGAGTGGTGTTCTCAGGTGCTGGAGG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... PDIA2(69191), Pdia2(69191)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Takamasa Inoue et al.
Journal of virology, 89(17), 8897-8908 (2015-06-19)
The nonenveloped polyomavirus (PyV) simian virus 40 (SV40) traffics from the cell surface to the endoplasmic reticulum (ER), where it penetrates the ER membrane to reach the cytosol before mobilizing into the nucleus to cause infection. Prior to ER membrane...
Esther Peña et al.
Thrombosis and haemostasis, 113(4), 891-902 (2015-01-30)
Protein-disulphide isomerase family (PDI) are an ER-stress protein that controls TF-procoagulant activity but its role in HVSMC migration and coronary artery disease remains to be elucidated. We aimed to investigate whether in human coronary smooth muscle cells (HVSMC) the ER-stress...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

MilliporeSigma

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.