HMC0002

Sigma-Aldrich

MISSION® miRNA, Negative Control 1

Sequence from Arabidopsis thaliana with no homology to human gene sequences

Synonym(s):
Mature Sequence: GGUUCGUACGUACACUGUUCA
NACRES:
NA.51

product line

MISSION®

storage temp.

−20°C

General description

MISSION® miRNA Negative Controls are an essential component to any miRNA experiment. Using a negative control allows the researcher to create a baseline for mRNA knockdown effciency. The negative controls have been carefully selected, and have no known homology to known human gene sequences. Negative Control 1 is based upon a Arabidopsis thaliana sequence.

Application

MISSION® miRNA, Negative Control 1 has been used as a negative control for miRNA transfections.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

WGK Germany

WGK 3

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Low-dose paclitaxel ameliorates fibrosis in the remnant kidney model by down-regulating miR-192
Sun, L. et al.
The Journal of Pathology, 3, 364-377 (2011)
Yumeng Wang et al.
Genome research, 27(7), 1112-1125 (2017-04-16)
RNA editing, a widespread post-transcriptional mechanism, has emerged as a new player in cancer biology. Recent studies have reported key roles for individual miRNA editing events, but a comprehensive picture of miRNA editing in human cancers remains largely unexplored. Here...
The Effects of Sequence Variation on Genome-wide NRF2 Binding--New Target Genes and Regulatory SNPs.
Kuosmanen SM et al.
Nucleic Acids Research, 44, 1760-1760 (2016)
MiR-578 and miR-573 as potential players in BRCA-related breast cancer angiogenesis.
Danza K et al.
Oncotarget, 6, 471-471 (2015)
A Egli et al.
American journal of transplantation : official journal of the American Society of Transplantation and the American Society of Transplant Surgeons, 16(2), 650-660 (2015-10-16)
Human (Homo sapiens) micro-RNAs (hsa-miRNAs) regulate virus and host-gene translation, but the biological impact in patients with human cytomegalovirus (hCMV) infection is not well defined in a clinically relevant model. First, we compared hsa-miRNA expression profiles in peripheral blood mononuclear...
Articles
Sigma-Aldrich presents an article about microRNAs (miRNAs), which are a class of naturally occurring small non-coding RNA molecules that regulate a variety of developmental and physiological processes.
Read More

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

MilliporeSigma

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.