All Photos(1)

HMC0002

Sigma-Aldrich

MISSION® miRNA, Negative Control 1

Sequence from Arabidopsis thaliana with no homology to human gene sequences

Synonym(s):
Mature Sequence: GGUUCGUACGUACACUGUUCA
NACRES:
NA.51

product line

MISSION®

storage temp.

−20°C

General description

MISSION® miRNA Negative Controls are an essential component to any miRNA experiment. Using a negative control allows the researcher to create a baseline for mRNA knockdown effciency. The negative controls have been carefully selected, and have no known homology to known human gene sequences. Negative Control 1 is based upon a Arabidopsis thaliana sequence.

Application

MISSION® miRNA, Negative Control 1 has been used as a negative control for miRNA transfections.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Storage Class Code

13 - Non Combustible Solids

WGK

WGK 3

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis

Certificate of Origin

The Effects of Sequence Variation on Genome-wide NRF2 Binding--New Target Genes and Regulatory SNPs.
Kuosmanen SM et al.
Nucleic Acids Research, 44, 1760-1760 (2016)
Yumeng Wang et al.
Genome research, 27(7), 1112-1125 (2017-04-16)
RNA editing, a widespread post-transcriptional mechanism, has emerged as a new player in cancer biology. Recent studies have reported key roles for individual miRNA editing events, but a comprehensive picture of miRNA editing in human cancers remains largely unexplored. Here
MiR-578 and miR-573 as potential players in BRCA-related breast cancer angiogenesis.
Danza K et al.
Oncotarget, 6, 471-471 (2015)
Low-dose paclitaxel ameliorates fibrosis in the remnant kidney model by down-regulating miR-192
Sun, L. et al.
The Journal of Pathology, 3, 364-377 (2011)
Xiang Song et al.
Acta biochimica et biophysica Sinica, 51(4), 386-392 (2019-03-07)
LncRNA NEF has been proved to be a tumor suppressor in liver cancer. In the present study, we found that lncRNA NEF was downregulated and miRNA-155 was upregulated in plasma of triple-negative breast cancer (TNBC) patients compared with those in

Articles

Genome-wide Collection of Lenti 3’UTR Reporters for Functional Validation of microRNA Targets

Sigma-Aldrich presents an article about microRNAs (miRNAs), which are a class of naturally occurring small non-coding RNA molecules that regulate a variety of developmental and physiological processes.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service