HMC0003

Sigma-Aldrich

MISSION® miRNA, Negative Control 2

Sequence from Caenorhabditis elegans with no homology to human gene sequences

Synonym(s):
Mature Sequence: CGGUACGAUCGCGGCGGGAUAUC
NACRES:
NA.51

product line

MISSION®

storage temp.

−20°C

General description

MISSION® miRNA Negative Controls are an essential component to any miRNA experiment. Using a negative control allows the researcher to create a baseline for mRNA knockdown effciency. The negative controls have been carefully selected, and have no known homology to known human gene sequences. Negative Control 2 is based upon a Caenorhabditis elegans sequence.

Application

MISSION® miRNA, Negative Control 2 has been used as a negative control for miRNA transfections.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

WGK Germany

WGK 3

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
NOD2 expression is regulated by microRNAs in colonic epithelial HCT116 cells.
Chuang AY et al.
Inflammatory bowel diseases, 20, 126-126 (2014)
miRepress: modelling gene expression regulation by microRNA with non-conventional binding sites.
Ghosal S et al.
Scientific Reports, 6, 22334-22334 (2016)
Low-dose paclitaxel ameliorates fibrosis in the remnant kidney model by down-regulating miR-192
Sun, L. et al.
The Journal of Physiology, 3, 364-377 (2011)
Genome-Wide MicroRNA and Gene Analysis of Mesenchymal Stem Cell Chondrogenesis Identifies an Essential Role and Multiple Targets for miR-140-5p.
Barter MJ et al.
Stem Cells, 33, 3266-3266 (2015)
Utpreksha Vaish et al.
Scientific reports, 9(1), 10079-10079 (2019-07-14)
Translation of genes is regulated by many factors including microRNAs (miRNAs). miRNA profiling of lesional and non-lesional epidermal RNA from 18 vitiligo patients revealed significant upregulation of 29 miRNAs in the lesional epidermis, of which 6 miRNAs were transfected in...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

MilliporeSigma

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.