All Photos(1)

HUTR01430

Sigma-Aldrich

MISSION® 3′UTR Lenti GoClone

Powered by SwitchGear Genomics, 3′UTR, human, GAPDH

Synonym(s):
HUTR
NACRES:
NA.51

description

Functional Validation of miRNA Gene Targets

Quality Level

product line

MISSION®

concentration

≥1x105 VP/ml (via p24 assay)

human 3′UTR sequence

ACAACGAATTTGGCTACAGCAACAGGGTGGTGGACCTCATGGCCCACATGGCCTCCAAGGAGTAAGACCCCTGGACCACCAGCCCCAGCAAGAGCACAAG

NCBI accession no.

shipped in

dry ice

storage temp.

−70°C

Gene Information

human ... GAPDH(2597)

Application

To see more application data, protocols, and vector maps visit www.sigma.com/3utr.

Physical form

200 μL of at least 105 VP/mL (via p24 titering assay) lentiviral particles are provided as frozen stock.

Legal Information

Use of this product is subject to one or more license agreements. For details, please see www.sigmaaldrich.com/missionlicense.
GoClone is a trademark of SwitchGear Genomics
MISSION is a registered trademark of Sigma-Aldrich Co. LLC
SwitchGear Genomics is a trademark of SwitchGear Genomics

Certificate of Analysis

Certificate of Origin

Articles

Genome-wide Collection of Lenti 3’UTR Reporters for Functional Validation of microRNA Targets

Sigma-Aldrich presents an article about microRNAs (miRNAs), which are a class of naturally occurring small non-coding RNA molecules that regulate a variety of developmental and physiological processes.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service