NCSTUD001

Sigma-Aldrich

MISSION® Synthetic microRNA Inhibitor

ath-miR416, Negative Control 1, Sequence from Arabidopsis thaliana with no homology to human and mouse gene sequences

Synonym(s):
Synthetic Tough Decoy, sTuD
NACRES:
NA.51

product line

MISSION®

mature sequence

GGUUCGUACGUACACUGUUCA

Sanger mature/minor accession no.

Sanger microRNA accession no.

storage temp.

−20°C

Looking for similar products? Visit Product Comparison Guide

General description

Individual synthetic microRNA inhibitors were designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo.† This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation.

The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.

  • Long lasting inhibition at very low dosage
  • Excellent resistance to cellular nucleases
  • Custom synthesis available for a variety of species

Other Notes

Based on miRBase V19

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Pictograms

Health hazard

Signal Word

Warning

Hazard Statements

Precautionary Statements

Target Organs

Respiratory Tract

RIDADR

NONH for all modes of transport

WGK Germany

WGK 3

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Qing-Yan Lin et al.
Biotechnology letters, 42(1), 35-44 (2019-11-25)
The study is to research how miR-34-SIRT1 is regulated during hypoxia in lung cancer cells. Analysis of publicly available datasets from patients with NSCLC did not reveal significant genomic alterations in RBM38, SIRT1, HIF1A, MIR34A, MIR34B, and MIR34C, but expectedly...
Yao Dai et al.
Redox biology, 16, 255-262 (2018-03-20)
Several miR/s that regulate gene/s relevant in atherogenesis are being described. We identified a miR (miR-98) that targets LOX-1, a receptor for ox-LDL, and speculated that it might be relevant in atherogenesis. MicroRNA-98 was predicted by bioinformatics tools. The effects...
Ilker Tinay et al.
The Prostate, 78(12), 927-937 (2018-05-12)
MicroRNAs (miRNAs) are small non-coding RNAs, which negatively regulate gene expression and impact prostate cancer (PCa) growth and progression. Circulating miRNAs are stable and detectable in cell-free body fluids, such as serum. Investigation of circulating miRNAs presents great potential in...
Anumeha Singh et al.
The EMBO journal, 38(16), e100727-e100727 (2019-07-23)
Translational readthrough generates proteins with extended C-termini, which often possess distinct properties. Here, we have used various reporter assays to demonstrate translational readthrough of AGO1 mRNA. Analysis of ribosome profiling data and mass spectrometry data provided additional evidence for translational...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

MilliporeSigma

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.