MilliporeSigma
All Photos(1)

Documents

CHA00011

EUR-2019-nCoV Assays for detection of SARS-CoV-2 RNA

Sign Into View Organizational & Contract Pricing

form

solution (in 10 mM Tris, 1 mM EDTA)

packaging

pkg of 2 vials

pH range

7.5-8.5

shipped in

ambient

storage temp.

−20°C

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
CHA00011ACHA00011BEURM019
shipped in

ambient

shipped in

ambient

shipped in

ambient

shipped in

-

packaging

pkg of 2 vials

packaging

pkg of 1 vial

packaging

pkg of 1 vial

packaging

-

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

pH range

7.5-8.5

pH range

7.5-8.5

pH range

7.5-8.5

pH range

-

General description

EUR-2019-nCoV Assays are for qPCR (5′ nuclease assay) detection of SARS-CoV-2.

The product is primers and probes, the sequences of which were designed and made publicly available by Charité Institute of Virology – Universitätsmedizin Berlin.

For additional details, please visit SigmaAldrich.com/ncov.

Features and Benefits

The forward and reverse primers in each tube come with the following features:

  • DNA bases
  • No modifications
  • Desalt purified
  • 8 nmol each E_Sarbeco & 10 nmol each Modified RdRp

The Dual-Labeled Probe in each tube comes with the following features:

  • DNA bases
  • 6-FAM reporter
  • BXQ (Block All Quencher—SigmaAldrich.com/bxq)
  • HPLC purified
  • 4 nmol E_Sarbeco & 5 nmol Modified RdRp

Components

The product includes 2 individual tubes of 20X primer and probe pools for quantification of SARS-CoV-2 genes. Assays included are E_Sarbeco and Modified RdRp (formerly Discrimatory) genes.

The forward primer, reverse primer, and probe are at final concentrations of 8, 8, and 4 μM (E_Sarbeco); and, 10, 10, and 5 μM (Modified RdRp), respectively.

E_Sarbeco Assay:
Forward Primer ACAGGTACGTTAATAGTTAATAGCGT
Reverse Primer ATATTGCAGCAGTACGCACACA
Dual-Labeled Probe ACACTAGCCATCCTTACTGCGCTTCG

Modified RdRp Assay:
Forward Primer AAATGGTCATGTGTGGCGGT
Reverse Primer GTTAAAAACACTATTAGCATAAGCAGTTGT
Dual-Labeled Probe CAGGTGGAACCTCATCAGGAGATGC

Legal Information

FAM is a trademark of Applera Corporation or its subsidiaries in the US and/or certain other countries

Storage Class

12 - Non Combustible Liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service