EHU013251

Sigma-Aldrich

MISSION® esiRNA

targeting human SULT2A1

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGTTTGACCACATTCATGGCTGGATGCCCATGAGAGAGGAGAAAAACTTCCTGTTACTGAGTTATGAGGAGCTGAAACAGGACACAGGAAGAACCATAGAGAAGATCTGTCAATTCCTGGGAAAGACGTTAGAACCCGAAGAACTGAACTTAATTCTCAAGAACAGCTCCTTTCAGAGCATGAAAGAAAACAAGATGTCCAATTATTCCCTCCTGAGTGTTGATTATGTAGTGGACAAAGCACAACTTCTGAGAAAAGGTGTATCTGGGGACTGGAAAAATCACTTCACAGTGGCCCAAGCTGAAGACTTTGATAAATTGTTCCAAGAGAAGATGGCAGATCTTCCTCGAGAGCTGTTCCCATGGGAATAACGTCCAAAACACTCTGGATCTTATATGGAGAATGACATTGATTCTCCTGTCCTTGTACATGTACCTGACTGGGGTCATTGTGTAAGACTTATTATTTTATCCTGAAACCTTAAATATCAAACCTCTGCATCTCTGATCCCTTCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

storage_class_code

12 - Non Combustible Liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis

Certificate of Origin

Xi-Xiang Yu et al.
Digestive diseases and sciences, 60(5), 1265-1272 (2015-02-07)
As a pro-inflammatory cytokine, IL-33 has been demonstrated to play an important role in tumor progression. It is reported that IL-33 is highly expressed in the serum and tumor tissues of patients with gastric cancer. However, the function of IL-33...
S Stojkovic et al.
Journal of thrombosis and haemostasis : JTH, 12(6), 948-957 (2014-04-08)
Urokinase-type plasminogen activator (u-PA) plays a pivotal role in extracellular proteolysis and is thought to be critically involved in the modulation of angiogenesis. Interleukin (IL)-33 is a member of the IL-1 cytokine family, which is thought to act as danger...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service