MilliporeSigma
All Photos(1)

Documents

EHU023471

Sigma-Aldrich

MISSION® esiRNA

targeting human NT5E

Sign Into View Organizational & Contract Pricing

Select a Size

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGGAAGGTTCCTGTAGTCCAGGCCTATGCTTTTGGCAAATACCTAGGCTATCTGAAGATCGAGTTTGATGAAAGAGGAAACGTCATCTCTTCCCATGGAAATCCCATTCTTCTAAACAGCAGCATTCCTGAAGATCCAAGCATAAAAGCAGACATTAACAAATGGAGGATAAAATTGGATAATTATTCTACCCAGGAATTAGGGAAAACAATTGTCTATCTGGATGGCTCCTCTCAATCATGCCGCTTTAGAGAATGCAACATGGGCAACCTGATTTGTGATGCAATGATTAACAACAACCTGAGACACACGGATGAAATGTTCTGGAACCACGTATCCATGTGCATTTTAAATGGAGGTGGTATCCGGTCGCCCATTGATGAACGCAACAATGGCACAATTACCTGGGAGAACCTGGCTGCTGTATTGCCCTTTGGAGGCACATTTGACCTAGTCCAGTTAAAAGGTTCCACCCTGAAGAAGGCCTTTGAGCAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EHU051331EHU155451EHU060761
MISSION® esiRNA targeting human NT5E

Sigma-Aldrich

EHU023471

MISSION® esiRNA

MISSION® esiRNA targeting human NSF

Sigma-Aldrich

EHU051331

MISSION® esiRNA

MISSION® esiRNA targeting human OGDH

Sigma-Aldrich

EHU155451

MISSION® esiRNA

MISSION® esiRNA targeting human OPRL1

Sigma-Aldrich

EHU060761

MISSION® esiRNA

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

esiRNA cDNA target sequence

CGGAAGGTTCCTGTAGTCCAGGCCTATGCTTTTGGCAAATACCTAGGCTATCTGAAGATCGAGTTTGATGAAAGAGGAAACGTCATCTCTTCCCATGGAAATCCCATTCTTCTAAACAGCAGCATTCCTGAAGATCCAAGCATAAAAGCAGACATTAACAAATGGAGGATAAAATTGGATAATTATTCTACCCAGGAATTAGGGAAAACAATTGTCTATCTGGATGGCTCCTCTCAATCATGCCGCTTTAGAGAATGCAACATGGGCAACCTGATTTGTGATGCAATGATTAACAACAACCTGAGACACACGGATGAAATGTTCTGGAACCACGTATCCATGTGCATTTTAAATGGAGGTGGTATCCGGTCGCCCATTGATGAACGCAACAATGGCACAATTACCTGGGAGAACCTGGCTGCTGTATTGCCCTTTGGAGGCACATTTGACCTAGTCCAGTTAAAAGGTTCCACCCTGAAGAAGGCCTTTGAGCAT

esiRNA cDNA target sequence

CTGGTAGCACGGGAGTTCATGACACTGTTGTCAACCAGTTGCTGTCCAAAATTGATGGCGTGGAGCAGCTAAACAACATCCTAGTCATTGGAATGACCAATAGACCAGATCTGATAGATGAGGCTCTTCTTAGACCTGGAAGACTGGAAGTTAAAATGGAGATAGGCTTGCCAGATGAGAAAGGCCGACTACAGATTCTTCACATCCACACAGCAAGAATGAGAGGGCATCAGTTACTCTCTGCTGATGTAGACATTAAAGAACTGGCCGTGGAGACCAAGAATTTCAGTGGTGCTGAATTGGAGGGTCTGGTGCGAGCAGCCCAGTCCACTGCTATGAATAGACACATAAAGGCCAGTACTAAAGTGGAAGTGGACATGGAGAAAGCAGAAAGCCTGCAA

esiRNA cDNA target sequence

GGAATCAGCACTTCCTCTGCGGGAGATCATCCGTCGGCTGGAGATGGCCTACTGCCAGCATATTGGGGTGGAGTTCATGTTCATCAATGACCTGGAGCAGTGCCAGTGGATCCGGCAGAAGTTTGAGACCCCTGGGATCATGCAGTTCACAAATGAGGAGAAACGGACCCTGCTGGCCAGGCTTGTGCGGTCCACCAGGTTTGAGGAGTTCCTACAGCGGAAGTGGTCCTCTGAGAAGCGCTTTGGTCTAGAAGGCTGCGAGGTACTGATCCCTGCCCTCAAGACCATCATTGACAAGTCTAGTGAGAATGGCGTGGACTACGTGATCATGGGCATGCCACACAGAGGGCGGCTGAACGTGCTTGCAAATGTCATCAGGAAGGAGCTGGAACAGATCTTCTGTCAATTCGATTCAAAGCTGGAGGCAGCTGATGAGGGCTCCGGAGATGTGAAGTACCACCTGGGCAT

esiRNA cDNA target sequence

TATCTACGGCAGCCACCTTCAGGGCAACCTGTCCCTCCTGAGCCCCAACCACAGTCTGCTGCCCCCGCATCTGCTGCTCAATGCCAGCCACGGCGCCTTCCTGCCCCTCGGGCTCAAGGTCACCATCGTGGGGCTCTACCTGGCCGTGTGTGTCGGAGGGCTCCTGGGGAACTGCCTTGTCATGTACGTCATCCTCAGGCACACCAAAATGAAGACAGCCACCAATATTTACATCTTTAACCTGGCCCTGGCCGACACTCTGGTCCTGCTGACGCTGCCCTTCCAGGGCACGGACATCCTCCTGGGCTTCTGGCCGTTTGGGAATGCGCTGTGCAAGACAGTCATTGCCATTGACTACTACAACATGTTCACCAGCACCTTCACCCTAACTGCCATGAGTGTGGATCGCTATGTAGCCA

Ensembl | human accession no.

ENSG00000135318

Ensembl | human accession no.

ENSG00000073969

Ensembl | human accession no.

ENSG00000105953

Ensembl | human accession no.

ENSG00000125510

NCBI accession no.

NM_002526

NCBI accession no.

NM_006178

NCBI accession no.

NM_002541

NCBI accession no.

NM_182647

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Young Mun Jeong et al.
Cancers, 12(10) (2020-10-23)
CD73 is involved in tumor immune escape and promotes the growth and progression of cancer cells. The functional role of CD73 expression in papillary thyroid carcinoma (PTC) has not yet been established. In 511 patients with PTC, immunohistochemistry for CD73
Jaden S Lee et al.
Virulence, 11(1), 414-429 (2020-05-19)
Cell surface nucleotide-metabolizing enzyme, ectonucleotidase-CD73, has emerged as a central component of the cellular homeostatic-machinery that counterbalances the danger-molecule (extracellular-ATP)-driven proinflammatory response in immune cells. While the importance of CD73 in microbial host fitness and symbiosis is gradually being unraveled
Dominik Eichin et al.
European journal of immunology, 51(1), 231-246 (2020-09-25)
CD73 is an important ectoenzyme responsible for the production of extracellular adenosine. It is involved in regulating inflammatory responses and cell migration and is overexpressed in various cancers. The functions of CD73 in blood endothelial cells are understood in detail
Brett Verstak et al.
Journal of leukocyte biology, 96(3), 427-436 (2014-05-09)
TLRs act as sentinels in professional immune cells to detect and initiate the innate immune response to pathogen challenge. TLR4 is a widely expressed TLR, responsible for initiating potent immune responses to LPS. TRAM acts to bridge TLR4 with TRIF
Gina Lisignoli et al.
Tissue engineering. Part A, 20(19-20), 2795-2805 (2014-04-10)
The use of short interfering RNA (siRNA) in combination with stem cells and biocompatible scaffolds is a promising strategy in regenerative medicine. Our experimental strategy was to explore the possibility of forcing or guiding the chondrogenic differentiation of human mesenchymal

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service