EHU029131

Sigma-Aldrich

MISSION® esiRNA

targeting human ATP5B

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGTGCACCAATCAAAATTCCTGTTGGTCCTGAGACTTTGGGCAGAATCATGAATGTCATTGGAGAACCTATTGATGAAAGAGGTCCCATCAAAACCAAACAATTTGCTCCCATTCATGCTGAGGCTCCAGAGTTCATGGAAATGAGTGTTGAGCAGGAAATTCTGGTGACTGGTATCAAGGTTGTCGATCTGCTAGCTCCCTATGCCAAGGGTGGCAAAATTGGGCTTTTTGGTGGTGCTGGAGTTGGCAAGACTGTACTGATCATGGAGTTAATCAACAATGTCGCCAAAGCCCATGGTGGTTACTCTGTGTTTGCTGGTGTTGGTGAGAGGACCCGTGAAGGCAATGATTTATACCATGAAATGATTGAATCTGGTGTTATCAACTTAAAAGATGCCACCTCTAAGGTAGCGCTGGTATATGGTCAAATGAATGAACCACCTGGTGCTCGTGCCCGGGTAGCTCTGACTGGGCTGACTGTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ATP5B(506), ATP5B(506)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Valentina Giorgio et al.
EMBO reports, 18(7), 1065-1076 (2017-05-17)
F-ATP synthases convert the electrochemical energy of the H
Uwe Richter et al.
The Journal of cell biology, 211(2), 373-389 (2015-10-28)
Mitochondrial ribosomes synthesize a subset of hydrophobic proteins required for assembly of the oxidative phosphorylation complexes. This process requires temporal and spatial coordination and regulation, so quality control of mitochondrial protein synthesis is paramount to maintain proteostasis. We show how...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

MilliporeSigma

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.