MilliporeSigma
All Photos(1)

Documents

EHU029271

Sigma-Aldrich

MISSION® esiRNA

targeting human GFAP

Sign Into View Organizational & Contract Pricing

NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGGTGAAGACCGTGGAGATGCGGGATGGAGAGGTCATTAAGGAGTCCAAGCAGGAGCACAAGGATGTGATGTGAGGCAGGACCCACCTGGTGGCCTCTGCCCCGTCTCATGAGGGGCCCGAGCAGAAGCAGGATAGTTGCTCCGCCTCTGCTGGCACATTTCCCCAGACCTGAGCTCCCCACCACCCCAGCTGCTCCCCTCCCTCCTCTGTCCCTAGGTCAGCTTGCTGCCCTAGGCTCCGTCAGTATCAGGCCTGCCAGACGGCACCCACCCAGCACCCAGCAACTCCAACTAACAAGAAACTCACCCCCAAGGGGCAGTCTGGAGGGGCATGGCCAGCAGCTTGCGTTAGAATGAGGAGGAAGGAGAGAAGGGGAGGAGGGCGGGGGGCACCTACTACATCGCCCTCCACATC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EHU139211EHU115571EHU012781
MISSION® esiRNA targeting human GFAP

Sigma-Aldrich

EHU029271

MISSION® esiRNA

MISSION® esiRNA targeting human GGCX

Sigma-Aldrich

EHU139211

MISSION® esiRNA

MISSION® esiRNA targeting human GRK6

Sigma-Aldrich

EHU115571

MISSION® esiRNA

MISSION® esiRNA targeting human GAS2

Sigma-Aldrich

EHU012781

MISSION® esiRNA

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

esiRNA cDNA target sequence

GTGGTGAAGACCGTGGAGATGCGGGATGGAGAGGTCATTAAGGAGTCCAAGCAGGAGCACAAGGATGTGATGTGAGGCAGGACCCACCTGGTGGCCTCTGCCCCGTCTCATGAGGGGCCCGAGCAGAAGCAGGATAGTTGCTCCGCCTCTGCTGGCACATTTCCCCAGACCTGAGCTCCCCACCACCCCAGCTGCTCCCCTCCCTCCTCTGTCCCTAGGTCAGCTTGCTGCCCTAGGCTCCGTCAGTATCAGGCCTGCCAGACGGCACCCACCCAGCACCCAGCAACTCCAACTAACAAGAAACTCACCCCCAAGGGGCAGTCTGGAGGGGCATGGCCAGCAGCTTGCGTTAGAATGAGGAGGAAGGAGAGAAGGGGAGGAGGGCGGGGGGCACCTACTACATCGCCCTCCACATC

esiRNA cDNA target sequence

TTTCCATGAGCGATTCTTCCGCTTCTTGTTGCGAAAGCTCTATGTCTTTCGCCGCAGCTTCCTGATGACTTGTATCTCACTTCGAAATCTGATATTAGGCCGTCCTTCCCTGGAGCAGCTGGCCCAGGAGGTGACTTATGCAAACTTGAGACCCTTTGAGGCAGTTGGAGAACTGAATCCCTCAAACACGGATTCTTCACATTCTAATCCTCCTGAGTCAAATCCTGATCCTGTCCACTCAGAGTTCTGAAGGGGGCCAGATGTTGGGTGCAGATGTAGAAGCAGCCAGTCACAGACCCATTCTATGCAATGGACATTTATTTGAAAAAAATTCTCAAAAGTTTTTTTTTTTTTTTTGGGGGGGCGGGGTTCTAAAGCTGTTTTTAACTCCGAGATTACAACTTAGAGGAACCAAGGAAATAAAGCAAATAAGATTTAACAACCCAAGATTAAGAGGCCAGGA

esiRNA cDNA target sequence

GCCAGTGACCAAAAACACCTTCAGGCAATACCGAGTCCTGGGCAAAGGTGGCTTTGGGGAGGTGTGCGCCTGCCAGGTGCGGGCCACAGGTAAGATGTATGCCTGCAAGAAGCTAGAGAAAAAGCGGATCAAGAAGCGGAAAGGGGAGGCCATGGCGCTGAACGAGAAGCAGATCCTGGAGAAAGTGAACAGTAGGTTTGTAGTGAGCTTGGCCTACGCCTATGAGACCAAGGACGCGCTGTGCCTGGTGCTGACACTGATGAACGGGGGCGACCTCAAGTTCCACATCTACCACATGGGCCAGGCTGGCTTCCCCGAAGCGCGGGCCGTCTTCTACGCCGCCGAGATCTGCTGTGGCCTGGAGGACCTGCACCGGGAGCGCATCGTGTACAGGGACCTGA

esiRNA cDNA target sequence

GCAAGGCAGAGAACAAGACCTGTGCTTCTTTACTCCAAACTCTTAGCAGTGTGGACACTGATTAACTGCAGCTGGGGTCTGATTTGCCCAGCCTGTCTTTGATATTGATCAATGAACTCCTTCTCAAGGAATGCTTTCCTCTAACTGCGGTGAAGGTGGTGGCTCTGGTGGTTCTCTCCAACATGGGTGTCTGGGTTTTGACTGCCTAAGAGAAGGTATTACAAGTGGATAAATAATGTGCACTGCTCTGAGCCCAAAGGTACGCAGTGGACCTGGCCTCTCTGATATGCATCAGTATAGCCAATGGCTAGCCAGCAGACATGAAGCTAATTTGCTACCAATGAAAGAAGATCTGGCCTTGTGGTTAACCAATCTATTAGGGAAGGAGATTACAGCAGAAACTTTTATGGAGAAGTTGGACAATGGTGCC

Ensembl | human accession no.

ENSG00000131095

Ensembl | human accession no.

ENSG00000115486

Ensembl | human accession no.

ENSG00000198055

Ensembl | human accession no.

ENSG00000148935

NCBI accession no.

NM_002055

NCBI accession no.

NM_000821

NCBI accession no.

NM_001004106

NCBI accession no.

NM_005256, NM_177553

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Jong-Hyun Moon et al.
Journal of veterinary science, 16(2), 203-211 (2014-10-02)
In the present study, the use of dogs with experimental autoimmune encephalomyelitis (EAE) as a disease model for necrotizing encephalitis (NE) was assessed. Twelve healthy dogs were included in this study. Canine forebrain tissues (8 g), including white and grey
Se Jeong Lee et al.
BMC cancer, 15, 1011-1011 (2015-12-26)
Glioblastoma multiforme (GBM) is characterized by extensive local invasion, which is in contrast with extremely rare systemic metastasis of GBM. Molecular mechanisms inhibiting systemic metastasis of GBM would be a novel therapeutic candidate for GBM in the brain. Patient-derived GBM
Amy Treadwell et al.
Veterinary ophthalmology, 18(5), 371-380 (2014-09-02)
To characterize the clinical, diagnostic, and histopathologic findings in dogs with canine ocular gliovascular syndrome (COGS). The archives at the Comparative Ocular Pathology Laboratory of Wisconsin (COPLOW) were used to identify eyes with COGS. Histopathological inclusion criteria included: a neovascular

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service