MilliporeSigma
All Photos(1)

Documents

EHU038231

Sigma-Aldrich

MISSION® esiRNA

targeting human TNFAIP6

Sign Into View Organizational & Contract Pricing

Select a Size

NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCTAAGGCGGTGTGTGAATTTGAAGGCGGCCATCTCGCAACTTACAAGCAGCTAGAGGCAGCCAGAAAAATTGGATTTCATGTCTGTGCTGCTGGATGGATGGCTAAGGGCAGAGTTGGATACCCCATTGTGAAGCCAGGGCCCAACTGTGGATTTGGAAAAACTGGCATTATTGATTATGGAATCCGTCTCAATAGGAGTGAAAGATGGGATGCCTATTGCTACAACCCACACGCAAAGGAGTGTGGTGGCGTCTTTACAGATCCAAAGCAAATTTTTAAATCTCCAGGCTTCCCAAATGAGTACGAAGATAACCAAATCTGCTACTGGCACATTAGACTCAAGTATGGTCAGCGTATTCACCTGAGTTTTTTAGATTTTGACCTTGAAGATGACCCAGGTTGCTTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EHU040661EHU036441EHU123401
MISSION® esiRNA targeting human TNFAIP6

Sigma-Aldrich

EHU038231

MISSION® esiRNA

MISSION® esiRNA targeting human TNFAIP1

Sigma-Aldrich

EHU040661

MISSION® esiRNA

MISSION® esiRNA targeting human TNFAIP2

Sigma-Aldrich

EHU036441

MISSION® esiRNA

MISSION® esiRNA targeting human TNNT2

Sigma-Aldrich

EHU123401

MISSION® esiRNA

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

esiRNA cDNA target sequence

AGCTAAGGCGGTGTGTGAATTTGAAGGCGGCCATCTCGCAACTTACAAGCAGCTAGAGGCAGCCAGAAAAATTGGATTTCATGTCTGTGCTGCTGGATGGATGGCTAAGGGCAGAGTTGGATACCCCATTGTGAAGCCAGGGCCCAACTGTGGATTTGGAAAAACTGGCATTATTGATTATGGAATCCGTCTCAATAGGAGTGAAAGATGGGATGCCTATTGCTACAACCCACACGCAAAGGAGTGTGGTGGCGTCTTTACAGATCCAAAGCAAATTTTTAAATCTCCAGGCTTCCCAAATGAGTACGAAGATAACCAAATCTGCTACTGGCACATTAGACTCAAGTATGGTCAGCGTATTCACCTGAGTTTTTTAGATTTTGACCTTGAAGATGACCCAGGTTGCTTG

esiRNA cDNA target sequence

GAAAGCACTTTGGCACCATTTTGAATTACCTCCGAGATGACACCATCACCCTCCCTCAGAACCGGCAAGAAATCAAGGAATTGATGGCTGAAGCAAAGTATTACCTCATCCAGGGGCTGGTGAATATGTGCCAGAGTGCCCTGCAGGACAAGAAGGACTCCTACCAGCCTGTGTGCAACATCCCCATCATCACATCCCTAAAGGAGGAGGAGCGGCTCATCGAATCCTCCACCAAGCCCGTGGTGAAGCTGCTGTACAACAGAAGCAACAACAAGTATTCCTACACCAGCAACTCTGACGACCACCTGCTGAAAAACATCGAGCTGTTTGACAAGCTCTCCCTGCGCTTCAACGGCCGCGTGCTCTTCATCAAGGATGTCATTGGTGACGAGATCTGCTGCTGGTCCTTTTATGGCCAGGGCCGTAAGCTGGCAGAGGTGTGCTGTACCTCCATCGTGTATGCCA

esiRNA cDNA target sequence

CTGGACTTGGGCTCACAGATAAAGCGGGTGCTGCTGGTGGAGCTGCCTGCGTTCCTGAGGAGCTACCAGCGCGCCTTTAATGAATTTCTGGAGAGAGGCAAGCAGCTGACGAATTACAGGGCCAATGTTATTGCCAACATCAACAACTGCCTGTCCTTCCGGATGTCCATGGAGCAGAATTGGCAGGTACCCCAGGACACCCTGAGCCTCCTGCTGGGCCCCCTGGGTGAGCTCAAGAGCCACGGCTTTGACACCCTGCTCCAGAACCTGCATGAGGACCTGAAGCCACTGTTCAAGAGGTTCACGCACACCCGCTGGGCGGCCCCTGTGGAGACCCTGGAAAACATCATCGCCACTGTAGACACGAGGCTGCCTGAGTTCTCAGAGCTGCAGGGCTGTTTCCGGGAGGAGCTCATGGAGGCCTTGCACCTGCACCTGGTGAAGGAGTACATCATCCAACTCAGCAAGGG

esiRNA cDNA target sequence

GACCAGGGCAGAAGAAGATGAAGAAGAAGAGGAAGCAAAGGAGGCTGAAGATGGCCCAATGGAGGAGTCCAAACCAAAGCCCAGGTCGTTCATGCCCAACTTGGTGCCTCCCAAGATCCCCGATGGAGAGAGAGTGGACTTTGATGACATCCACCGGAAGCGCATGGAGAAGGACCTGAATGAGTTGCAGGCGCTGATCGAGGCTCACTTTGAGAACAGGAAGAAAGAGGAGGAGGAGCTCGTTTCTCTCAAAGACAGGATCGAGAGACGTCGGGCAGAGCGGGCCGAGCAGCAGCGCATCCGGAATGAGCGGGAGAAGGAGCGGCAGAACCGCCTGGCTGAAGAGAGGGCTCGACGAGAGGAGGAGGAGAACAGGAGGAAGGCTGAGGATGAGGCCCGGAAGAAGAAGGCTTTGTCCAACATGATGCATTTTGGGGGTTACATCCAGA

Ensembl | human accession no.

ENSG00000123610

Ensembl | human accession no.

ENSG00000109079

Ensembl | human accession no.

ENSG00000185215

Ensembl | human accession no.

ENSG00000118194

NCBI accession no.

NM_007115

NCBI accession no.

NM_021137

NCBI accession no.

NM_006291

NCBI accession no.

NM_000364

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Guohu Di et al.
Investigative ophthalmology & visual science, 58(10), 4344–4354-4344–4354 (2017-08-16)
To explore the role and mechanism of bone marrow-derived mesenchymal stem cells (BM-MSCs) in corneal epithelial wound healing in type 1 diabetic mice. Diabetic mice were treated with subconjunctival injections of BM-MSCs or recombinant tumor necrosis factor-α-stimulated gene/protein-6 (TSG-6). The
Tae-Hoon Shin et al.
Cell death & disease, 7(12), e2524-e2524 (2016-12-23)
Rheumatoid arthritis (RA) is a long-lasting intractable autoimmune disorder, which has become a substantial public health problem. Despite widespread use of biologic drugs, there have been uncertainties in efficacy and long-term safety. Mesenchymal stem cells (MSCs) have been suggested as
Xiangwen Zhang et al.
Tissue & cell, 68, 101455-101455 (2020-11-23)
TNFα-stimulated gene-6 (TNFAIP6) plays an important role in the prognosis of many tumors. Our objective was to investigate the clinical and prognostic value of TNFAIP6 expression in gastric cancer (GC) patients. Here, we investigated the expression of TNFAIP6 in GC
Hyun Beom Song et al.
Molecular therapy : the journal of the American Society of Gene Therapy, 26(1), 162-172 (2018-01-05)
The cornea is a transparent tissue devoid of blood and lymphatic vessels. However, various inflammatory conditions can cause hemangiogenesis and lymphangiogenesis in the cornea, compromising transparency and visual acuity. Mesenchymal stem/stromal cells (MSCs) have therapeutic potentials in a variety of
Young In Yun et al.
Cytotherapy, 19(1), 28-35 (2016-11-15)
Mesenchymal stromal cells (MSCs) offer tremendous potential for therapeutic applications for inflammatory diseases. However, tissue-derived MSCs, such as bone marrow-derived MSCs (BM-MSCs), have considerable donor variations and limited expandability. It was recently demonstrated that MSCs derived from induced pluripotent stem

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service