EHU053231

Sigma-Aldrich

MISSION® esiRNA

targeting human CD38

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTGGGAACTCAGACCGTACCTTGCAACAAGATTCTTCTTTGGAGCAGAATAAAAGATCTGGCCCATCAGTTCACACAGGTCCAGCGGGACATGTTCACCCTGGAGGACACGCTGCTAGGCTACCTTGCTGATGACCTCACATGGTGTGGTGAATTCAACACTTCCAAAATAAACTATCAATCTTGCCCAGACTGGAGAAAGGACTGCAGCAACAACCCTGTTTCAGTATTCTGGAAAACGGTTTCCCGCAGGTTTGCAGAAGCTGCCTGTGATGTGGTCCATGTGATGCTCAATGGATCCCGCAGTAAAATCTTTGACAAAAACAGCACTTTTGGGAGTGTGGAAGTCCATAATTTGCAACCAGAGAAGGTTCAGACACTAGAGGCCTGGGTGATACATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CD38(952), CD38(952)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Yoshio Ogura et al.
Aging, 12(12), 11325-11336 (2020-06-09)
Mitochondrial oxidative stress is a significant contributor to the pathogenesis of diabetic kidney disease (DKD). We previously showed that mitochondrial oxidative stress in the kidneys of Zucker diabetic fatty rats is associated with a decreased intracellular NAD+/NADH ratio and NAD+-dependent...
Cheng-Bo Song et al.
Journal of translational medicine, 18(1), 95-95 (2020-02-26)
Despite the effective antiretroviral treatment (ART) of HIV-infected individuals, HIV persists in a small pool. Central memory CD4+ T cells (Tcm) make a major contribution to HIV persistence. We found that unlike HLA-DR, CD38 is highly expressed on the Tcm...
Longfei Gao et al.
Frontiers in cellular neuroscience, 13, 316-316 (2019-07-23)
Mitochondria are the critical organelles for energy metabolism and cell survival in eukaryotic cells. Recent studies demonstrated that mitochondria can intercellularly transfer between mammalian cells. In neural cells, astrocytes transfer mitochondria into neurons in a CD38-dependent manner. Here, using co-culture...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

MilliporeSigma

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.