MilliporeSigma
All Photos(1)

Documents

EHU054811

Sigma-Aldrich

MISSION® esiRNA

targeting human CDT1

Sign Into View Organizational & Contract Pricing

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTAGGCGTTTTGAGGAGTGCAATGTTGGCCAGATCAAAACCGTGTACCCGGCCTCCTACCGCTTCCGCCAGGAGCGCAGTGTCCCCACCTTCAAGGATGGCACCAGGAGGTCAGATTACCAGCTCACCATCGAGCCACTGCTGGAGCAGGAGGCTGACGGAGCAGCCCCCCAGCTCACGGCCTCGCGCCTCCTGCAGCGACGGCAGATCTTCAGCCAGAAGCTGGTGGAGCATGTCAAGGAGCACCACAAGGCCTTCCTGGCCTCCCTGAGCCCCGCCATGGTGGTGCCGGAGGACCAGCTGACCCGCTGGCACCCGCGCTTCAACGTGGATGAAGTACCCGACATCGAGCCGGCCGCGCTGCCCCAGCCACCCGCCACGGAGAAGCTCACCACTGCTCAGGAGGTGCTGGCCCGGGCCCGCAACCTGATTTCACCCAGGATGGAGAAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EHU061531EHU031671EHU084291
MISSION® esiRNA targeting human CDT1

Sigma-Aldrich

EHU054811

MISSION® esiRNA

MISSION® esiRNA targeting human CDADC1

Sigma-Aldrich

EHU061531

MISSION® esiRNA

MISSION® esiRNA targeting human CD81

Sigma-Aldrich

EHU031671

MISSION® esiRNA

MISSION® esiRNA targeting human FAM83D

Sigma-Aldrich

EHU084291

MISSION® esiRNA

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

esiRNA cDNA target sequence

GTAGGCGTTTTGAGGAGTGCAATGTTGGCCAGATCAAAACCGTGTACCCGGCCTCCTACCGCTTCCGCCAGGAGCGCAGTGTCCCCACCTTCAAGGATGGCACCAGGAGGTCAGATTACCAGCTCACCATCGAGCCACTGCTGGAGCAGGAGGCTGACGGAGCAGCCCCCCAGCTCACGGCCTCGCGCCTCCTGCAGCGACGGCAGATCTTCAGCCAGAAGCTGGTGGAGCATGTCAAGGAGCACCACAAGGCCTTCCTGGCCTCCCTGAGCCCCGCCATGGTGGTGCCGGAGGACCAGCTGACCCGCTGGCACCCGCGCTTCAACGTGGATGAAGTACCCGACATCGAGCCGGCCGCGCTGCCCCAGCCACCCGCCACGGAGAAGCTCACCACTGCTCAGGAGGTGCTGGCCCGGGCCCGCAACCTGATTTCACCCAGGATGGAGAAG

esiRNA cDNA target sequence

AGCAAACCAAAAGATCACATTTATACCCAAAGCTTTCTAGTAATCAGAATTTACTTAATTAGAATTGACTCATAAAAATAAAGTTAGTGGACTTTGTCTCCATTTTTAAAGTATATTTTGTAAATGTTAATTCTGTGGTCCTGTTTATCACAGACTTTGGGTAGCAATAGGAAGAGAGTGTTATTCTGAGACAGTGTCGCTGCTTGATATCACTGACTCTTGAAATCACTAACAGTGAACCTCAAATTTGGTTATGATGTTAACAGAGAAGAAATATTTGAGTCTGGAATATTGAAACTAGCTTTCCTAGAATTCCATTAATAAATGCTGCTCCCCCATATAGTCTTCCCTTCTGTATAATTAACATAGGTTGTCTCATGGCTTTGATCTTCAAAAGGAAGAGCCTTTTAAAAACATTTGCCAACCTCAAGAATAAATACTGAAAGTCTTGAAAGTATGGTCATTTCAGCTATTCCAGA

esiRNA cDNA target sequence

GCTGTCATGATGTTCGTTGGCTTCCTGGGCTGCTACGGGGCCATCCAGGAATCCCAGTGCCTGCTGGGGACGTTCTTCACCTGCCTGGTCATCCTGTTTGCCTGTGAGGTGGCCGCCGGCATCTGGGGCTTTGTCAACAAGGACCAGATCGCCAAGGATGTGAAGCAGTTCTATGACCAGGCCCTACAGCAGGCCGTGGTGGATGATGACGCCAACAACGCCAAGGCTGTGGTGAAGACCTTCCACGAGACGCTTGACTGCTGTGGCTCCAGCACACTGACTGCTTTGACCACCTCAGTGCTCAAGAACAATTTGTGTCCCTCGGGCAGCAACATCATCAGCAACCTCTTCAAGGAGGACTGCCACCAGAAGATCGATGACCTCTTCTCCGGGAAGCTGTACCTCATCGGCAT

esiRNA cDNA target sequence

ACCTACTTCCCCGAGCAGTCGGACCTGGAGCCACCGCTGTTGGAGCTTGGCTGGCCCGCCTTCTACCAGGGCGCCTACCGCGGCGCCACGCGTGTCGAGACGCACTTCCAGCCCCGCGGCGCTGGCGAAGGTGGCCCCTACGGCTGCAAGGACGCTCTGCGCCAGCAGCTCCGCTCGGCGCGAGAGGTGATTGCAGTGGTCATGGACGTGTTCACAGACATCGACATCTTCAGAGACCTGCAAGAAATATGCAGGAAACAGGGAGTTGCTGTGTATATCCTTCTGGACCAGGCTCTCCTCTCTCAATTTCTGGATATGTGCATGGATCTGAAAGTTCATCCTGAACAGGAAAAGTTAATGACAGTTCGGACTATCACAGGAAATATCTACTATGCAAGGTCAGGAACTAAGATTATTGGGAAGGTTCACGAAAA

Ensembl | human accession no.

ENSG00000167513

Ensembl | human accession no.

ENSG00000102543

Ensembl | human accession no.

ENSG00000110651

Ensembl | human accession no.

ENSG00000101447

NCBI accession no.

NM_030928

NCBI accession no.

NM_030911

NCBI accession no.

NM_004356

NCBI accession no.

NM_030919

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Jacob Peter Matson et al.
The Journal of cell biology, 218(7), 2169-2184 (2019-06-13)
To maintain tissue homeostasis, cells transition between cell cycle quiescence and proliferation. An essential G1 process is minichromosome maintenance complex (MCM) loading at DNA replication origins to prepare for S phase, known as origin licensing. A p53-dependent origin licensing checkpoint

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service