EHU058421

Sigma-Aldrich

MISSION® esiRNA

targeting human BCL2L2

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGACAAGTGCAGGAGTGGATGGTGGCCTACCTGGAGACGCAGCTGGCTGACTGGATCCACAGCAGTGGGGGCTGGGCGGAGTTCACAGCTCTATACGGGGACGGGGCCCTGGAGGAGGCGCGGCGTCTGCGGGAGGGGAACTGGGCATCAGTGAGGACAGTGCTGACGGGGGCCGTGGCACTGGGGGCCCTGGTAACTGTAGGGGCCTTTTTTGCTAGCAAGTGAAAGTCCAGGGCCAGGTGGGGCTAGGTGTGGCTGGGGGCCAGGAGAGCAGGAACAGAACAGAGAAATGCCCTTGGAAGAAGTGGAGTTGGTGGATGGGTGGGCATGGAACAGGATGGGCAGAGAAAGGGTAGTGTGTGAGGGAGCTGAGTAGGCCAGGTAGGCGATTGGAAGAGTGAGCAGGACACAGAGGGGAGGGGAATGTTTTGGCAAGTTTAGGGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... BCL2L2(599), BCL2L2(599)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Si-Hong Liu et al.
International journal of biological sciences, 16(6), 935-946 (2020-03-07)
Lymphoma is a malignant disease of the hematopoietic system that typically affects B cells. The up-regulation of miR-148b is associated with radiosensitization in B-cell lymphoma (BCL). This study aimed to explore the role of miR-148b in regulating the radiosensitivity of...
L Fang et al.
European review for medical and pharmacological sciences, 21(13), 3069-3074 (2017-07-26)
Lung cancer seriously threats to patient's life and health. Cyramza is a therapeutic drug for inhibition of vessel formation and growth in clinical practice. The aim of this study was to investigate the effect of cyramza on growth and apoptosis...
Clare M Adams et al.
The Journal of clinical investigation, 127(2), 635-650 (2017-01-18)
Compromised apoptotic signaling is a prerequisite for tumorigenesis. The design of effective therapies for cancer treatment depends on a comprehensive understanding of the mechanisms that govern cell survival. The antiapoptotic proteins of the BCL-2 family are key regulators of cell...
Hai-Ning Liu et al.
Reproductive sciences (Thousand Oaks, Calif.), 27(1), 152-162 (2020-02-13)
Recurrent spontaneous abortion (RSA) is a common health problem that affects 1-5% of women in reproductive age. Plenty of studies have indicated that microRNAs (miRNAs) are involved in the occurrence of miscarriage. MiR-93 has a wide range of functions in...
Hyun Joo Chung et al.
Oncotarget, 6(21), 18429-18444 (2015-07-15)
Glioblastoma multiforme (GBM) is the most common malignant brain tumor and exhibits aggressive and invasive behavior. We previously identified four miRNAs-miR-29b, 494, 193a-3p, and 30e-with enhanced expression in GBM following treatment of ionizing radiation by miRNA microarray analysis. In this...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

MilliporeSigma

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.