MilliporeSigma
All Photos(1)

Documents

EHU066621

Sigma-Aldrich

MISSION® esiRNA

targeting human ARID1A

Sign Into View Organizational & Contract Pricing

Select a Size

NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCTCAAGTCTGGTCTCCTGGCAGAGAGCACATGGGCATTAGATACCATCAACATCCTGCTGTATGATGACAACAGCATCATGACCTTCAACCTCAGTCAGCTCCCAGGGTTGCTAGAGCTCCTTGTAGAATATTTCCGACGATGCCTGATTGAGATCTTTGGCATTTTAAAGGAGTATGAGGTGGGTGACCCAGGACAGAGAACGCTACTGGATCCTGGGAGGTTCAGCAAGGTGTCTAGTCCAGCTCCCATGGAGGGTGGGGAAGAAGAAGAAGAACTTCTAGGTCCTAAACTAGAAGAGGAAGAAGAAGAGGAAGTAGTTGAAAATGATGAGGAGATAGCCTTTTCAGGCAAGGACAAGCCAGCTTCAGAGAATAGTGAGGAGAAGCTGATCAGTAAGTTTGACAAGCTTCCAGTAAAGATCGTACAGAAGAATGATCCATTTGTGGTGGACTGCTCAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EHU024661EHU038901EHU091041
MISSION® esiRNA targeting human ARID1A

Sigma-Aldrich

EHU066621

MISSION® esiRNA

MISSION® esiRNA targeting human FBP2

Sigma-Aldrich

EHU024661

MISSION® esiRNA

MISSION® esiRNA targeting human ARID3A

Sigma-Aldrich

EHU038901

MISSION® esiRNA

MISSION® esiRNA targeting human ARID4A

Sigma-Aldrich

EHU091041

MISSION® esiRNA

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

esiRNA cDNA target sequence

CCCTCAAGTCTGGTCTCCTGGCAGAGAGCACATGGGCATTAGATACCATCAACATCCTGCTGTATGATGACAACAGCATCATGACCTTCAACCTCAGTCAGCTCCCAGGGTTGCTAGAGCTCCTTGTAGAATATTTCCGACGATGCCTGATTGAGATCTTTGGCATTTTAAAGGAGTATGAGGTGGGTGACCCAGGACAGAGAACGCTACTGGATCCTGGGAGGTTCAGCAAGGTGTCTAGTCCAGCTCCCATGGAGGGTGGGGAAGAAGAAGAAGAACTTCTAGGTCCTAAACTAGAAGAGGAAGAAGAAGAGGAAGTAGTTGAAAATGATGAGGAGATAGCCTTTTCAGGCAAGGACAAGCCAGCTTCAGAGAATAGTGAGGAGAAGCTGATCAGTAAGTTTGACAAGCTTCCAGTAAAGATCGTACAGAAGAATGATCCATTTGTGGTGGACTGCTCAGA

esiRNA cDNA target sequence

ACCCAGCTGCTGAACTCAATGCTGACGGCCATCAAAGCCATCTCCTCGGCTGTGCGCAAGGCCGGTCTGGCCCACCTGTATGGAATCGCAGGAAGCGTTAACGTGACGGGAGATGAGGTGAAGAAACTGGATGTGCTATCCAATTCCCTGGTGATCAACATGGTCCAATCCTCCTATAGTACCTGCGTCCTGGTCTCAGAAGAGAATAAGGACGCCATCATCACCGCCAAGGAGAAGCGGGGGAAATACGTGGTCTGCTTTGACCCACTGGATGGATCTTCCAATATTGACTGCCTGGCCTCCATCGGAACCATCTTTGCCATCTATAGAAAGACCTCAGAGGATGAGCCTTCTGAAAAGGATGCCCTGCAGTGTGGCCGCAATATTGTGGCCGCAGGTTATGCGCTGTACGGTAGTGC

esiRNA cDNA target sequence

TCCTTGACCTGTTCATGCTGTACGTGCTGGTGACGGAGAAGGGCGGCCTCGTGGAGGTCATCAACAAGAAGCTGTGGCGTGAGATCACCAAGGGCCTCAACCTGCCCACGTCCATCACCAGTGCAGCCTTCACCCTGCGGACCCAATACATGAAGTACCTGTACCCCTACGAGTGTGAGAAGCGGGGCCTCAGTAACCCCAATGAGCTCCAGGCAGCCATAGACAGCAACCGACGGGAGGGCCGGCGCCAGAGCTTTGGTGGCTCCCTCTTTGCCTACTCGCCAGGCGGGGCACACGGCATGCTCTCCTCACCCAAGCTACCCGTGTCCTCCCTGGGCCTGGCCGCAAGCACCAATGGCAGCTCCATCACCCCCGCCCCTAAGATCAAGAAAGAGGAGGACTCAGCCA

esiRNA cDNA target sequence

GGGTCCTTTAAGAGTTGGAGCTATTGTTGAAACAAGGACATCTGATGGATCTTTTCAGGAAGCTATTATCAGCAAGTTGACAGATGCTAGTTGGTATACCGTGGTGTTTGATGATGGTGATGAGCGAACATTGAGACGTACCTCACTTTGTCTGAAAGGAGAGAGACATTTTGCAGAGAGTGAGACACTTGACCAGCTTCCATTAACAAATCCAGAGCATTTTGGAACTCCAGTAATTGCAAAGAAGACGAACAGAGGAAGGAGATCTTCTCTTCCTGTTACTGAAGATGAAAAGGAAGAAGAAAGCAGTGAAGAGGAAGATGAAGACAAGCGCCGTCTCAATGATGAATTACTAGGAAAAGTTGTAAGTGTGGTGTCTGCAACGGAGAGGACTGAATGG

Ensembl | human accession no.

ENSG00000117713

Ensembl | human accession no.

ENSG00000130957

Ensembl | human accession no.

ENSG00000116017

Ensembl | human accession no.

ENSG00000032219

NCBI accession no.

NM_006015

NCBI accession no.

NM_003837

NCBI accession no.

NM_005224

NCBI accession no.

NM_023001

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Yu-Chun Tseng et al.
Molecular reproduction and development, 84(12), 1250-1256 (2017-11-28)
Mammalian embryos undergo dramatic epigenetic remodeling that can have a profound impact on both gene transcription and overall embryo developmental competence. Members of the SWI/SNF (Switch/Sucrose non-fermentable) family of chromatin-remodeling complexes reposition nucleosomes and alter transcription factor accessibility. These large
Tangshun Wang et al.
International journal of molecular medicine, 46(5), 1683-1694 (2020-10-02)
The loss of function mutation of AT‑rich interactive domain 1A (ARID1A) often occurs in patients with breast cancer. It has been found that ARID1A knockout can enhance both the migratory activity of renal carcinoma cells and their sensitivity to therapeutic drugs
Dakeun Lee et al.
OncoTargets and therapy, 10, 4153-4159 (2017-09-02)
The At-rich interactive domain 1A (ARID1A) is frequently mutated in gastric cancers (GCs) with a poor prognosis. Growing evidence indicates that loss of ARID1A expression leads to activation of the phosphatidylinositol 3-kinase (PI3K)/AKT pathway by AKT phosphorylation. We aim to
Wen Xiao et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 43(6), 2420-2433 (2017-10-27)
We previously performed microRNA (miRNA) microarray to identify effective indicators of clear cell renal cell carcinoma (ccRCC) tissue samples and preoperative/postoperative plasma in which we identified miR-144-3p as an oncomiRNA. However, the molecular mechanism of miR-144-3p remains unclear. This study
Yan Yang et al.
Anti-cancer drugs, 31(4), 368-376 (2020-01-09)
Gastric cancer (GC) is lethal and there is an urgent need for improved understanding of this disease. Recent studies have reported that microRNAs (miRNAs) play increasingly important roles in the regulation of GC. In this study, we explored the target

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service