MilliporeSigma
All Photos(1)

Documents

EHU077121

Sigma-Aldrich

MISSION® esiRNA

targeting human OCLN

Sign Into View Organizational & Contract Pricing

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGGGAAGAGCAGGAAGGTCAAAGAGAACAGAGCAAGATCACTATGAGACAGACTACACAACTGGCGGCGAGTCCTGTGATGAGCTGGAGGAGGACTGGATCAGGGAATATCCACCTATCACTTCAGATCAACAAAGACAACTGTACAAGAGGAATTTTGACACTGGCCTACAGGAATACAAGAGCTTACAATCAGAACTTGATGAGATCAATAAAGAACTCTCCCGTTTGGATAAAGAATTGGATGACTATAGAGAAGAAAGTGAAGAGTACATGGCTGCTGCTGATGAATACAATAGACTGAAGCAAGTGAAGGGATCTGCAGATTACAAAAGTAAGAAGAATCATTGCAAGCAGTTAAAGAGCAAATTGTCACACATCAAGAAGATGGTTGGAGACTATGATAGACAGAAAACATAGAAGGCTGATGCCAAGTTGTTTGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EHU113851EHU079671EHU136661
MISSION® esiRNA targeting human OCLN

EHU077121

MISSION® esiRNA

MISSION® esiRNA targeting human PABPC1

EHU113851

MISSION® esiRNA

MISSION® esiRNA targeting human NPAS2

EHU079671

MISSION® esiRNA

MISSION® esiRNA targeting human NCLN

EHU136661

MISSION® esiRNA

esiRNA cDNA target sequence

AAGGGAAGAGCAGGAAGGTCAAAGAGAACAGAGCAAGATCACTATGAGACAGACTACACAACTGGCGGCGAGTCCTGTGATGAGCTGGAGGAGGACTGGATCAGGGAATATCCACCTATCACTTCAGATCAACAAAGACAACTGTACAAGAGGAATTTTGACACTGGCCTACAGGAATACAAGAGCTTACAATCAGAACTTGATGAGATCAATAAAGAACTCTCCCGTTTGGATAAAGAATTGGATGACTATAGAGAAGAAAGTGAAGAGTACATGGCTGCTGCTGATGAATACAATAGACTGAAGCAAGTGAAGGGATCTGCAGATTACAAAAGTAAGAAGAATCATTGCAAGCAGTTAAAGAGCAAATTGTCACACATCAAGAAGATGGTTGGAGACTATGATAGACAGAAAACATAGAAGGCTGATGCCAAGTTGTTTGA

esiRNA cDNA target sequence

TGCTCCTAAATGATCGCAAAGTATTTGTTGGACGATTTAAGTCTCGTAAAGAACGAGAAGCTGAACTTGGAGCTAGGGCAAAAGAATTCACCAATGTTTACATCAAGAATTTTGGAGAAGACATGGATGATGAGCGCCTTAAGGATCTCTTTGGCAAGTTTGGGCCTGCCTTAAGTGTGAAAGTAATGACTGATGAAAGTGGAAAATCCAAAGGATTTGGATTTGTAAGCTTTGAAAGGCATGAAGATGCACAGAAAGCTGTGGATGAGATGAACGGAAAGGAGCTCAATGGAAAACAAATTTATGTTGGTCGAGCTCAGAAAAAGGTGGAACGGCAGACGGAACTTAAGCGCAAATTTGAACAGATGAAACAAGATAGGATCACCAGATACCAGGGTGTTAATCTTTATGTGAAAAATCTTGATGATGGTATTGATGATGAACGTCTCCGGAAAGAGT

esiRNA cDNA target sequence

AATGGACAAAACCACCGTGTTGGAAAAGGTCATCGGATTTTTGCAGAAACACAATGAAGTCTCAGCGCAAACGGAAATCTGTGACATTCAGCAAGACTGGAAGCCTTCATTCCTCAGTAATGAAGAATTCACCCAGCTGATGTTGGAGGCATTAGATGGCTTCATTATCGCAGTGACAACAGACGGCAGCATCATCTATGTCTCTGACAGTATCACGCCTCTCCTTGGGCATTTACCGTCGGATGTCATGGATCAGAATTTGTTAAATTTCCTCCCAGAACAAGAACATTCAGAAGTTTATAAAATCCTTTCTTCCCATATGCTTGTGACGGATTCCCCCTCCCCAGAATACTTAAAATCTGACAGCGATTTAGAGTTTTATTGCCATCTTCTCAGAGGCAGCT

esiRNA cDNA target sequence

CTGACCCGTAACACGAGGATCATTGCAGAGGCCCTGACTCGAGTCATCTACAACCTGACAGAGAAGGGGACACCCCCAGACATGCCGGTGTTCACAGAGCAGATGCAGATCCAGCAGGAGCAGCTGGACTCGGTGATGGACTGGCTCACCAACCAGCCGCGGGCCGCGCAGCTGGTGGACAAGGACAGCACCTTCCTCAGCACGCTGGAGCACCACCTGAGCCGCTACCTGAAGGACGTGAAGCAGCACCACGTCAAGGCTGACAAGCGGGACCCAGAGTTTGTCTTCTACGACCAGCTGAAGCAAGTGATGAATGCGTACAGAGTCAAGCCGGCCGTCTTTGACCTGCTCCTGGCTGTTGGCATTGCTGCCTACCTCGGCATGGCCTACGTGGCTGTCCAGCACTTCAGCCTCCTCTACAAGACCGTCCAGAGGC

Gene Information

human ... OCLN(100506658), OCLN(4950)

Gene Information

human ... PABPC1(26986), PABPC1(5042)

Gene Information

human ... NPAS2(4862), NPAS2(4862)

Gene Information

human ... NCLN(56926), NCLN(56926)

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

NCBI accession no.

NM_002538

NCBI accession no.

NM_002568

NCBI accession no.

NM_002518

NCBI accession no.

NM_020170

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

James Keaney et al.
Science advances, 1(8), e1500472-e1500472 (2015-10-23)
The blood-brain barrier (BBB) is essential for maintaining brain homeostasis and protecting neural tissue from damaging blood-borne agents. The barrier is characterized by endothelial tight junctions that limit passive paracellular diffusion of polar solutes and macromolecules from blood to brain.
Kentaro Jingushi et al.
International journal of oncology, 51(1), 289-297 (2017-05-24)
Renal cell carcinoma (RCC) is the most common neoplasm of the adult kidney, and clear cell RCC (ccRCC) represents its most common histological subtype. Although several studies have reported high expression of miR-122 in ccRCC, its physiological role remains unclear.
Thomas Volksdorf et al.
The American journal of pathology, 187(6), 1301-1312 (2017-04-17)
Tight junction (TJ) proteins are known to be involved in proliferation and differentiation. These processes are essential for normal skin wound healing. Here, we investigated the TJ proteins claudin-1 and occludin in ex vivo skin wound healing models and tissue samples
Hiroshi Tokuo et al.
Molecular biology of the cell, 24(18), 2820-2833 (2013-07-19)
Cooperation between cadherins and the actin cytoskeleton controls the formation and maintenance of cell-cell adhesions in epithelia. We find that the molecular motor protein myosin-1c (Myo1c) regulates the dynamic stability of E-cadherin-based cell-cell contacts. In Myo1c-depleted Madin-Darby canine kidney cells
Dalia S Elhelw et al.
Archives of virology, 162(11), 3283-3291 (2017-06-24)
Occludin (OCLN) is an essential factor for HCV entry through interacting with other surface receptors. The aim of this study was to investigate the epigenetic regulation of Occludin expression and to study its impact on viral infectivity. microRNAs expression was

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service