MilliporeSigma
All Photos(1)

Documents

EHU078971

Sigma-Aldrich

MISSION® esiRNA

targeting human TFRC

Sign Into View Organizational & Contract Pricing

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCCAGCAAAGTTGAGAAACTCACTTTAGACAATGCTGCTTTCCCTTTCCTTGCATATTCTGGAATCCCAGCAGTTTCTTTCTGTTTTTGCGAGGACACAGATTATCCTTATTTGGGTACCACCATGGACACCTATAAGGAACTGATTGAGAGGATTCCTGAGTTGAACAAAGTGGCACGAGCAGCTGCAGAGGTCGCTGGTCAGTTCGTGATTAAACTAACCCATGATGTTGAATTGAACCTGGACTATGAGAGGTACAACAGCCAACTGCTTTCATTTGTGAGGGATCTGAACCAATACAGAGCAGACATAAAGGAAATGGGCCTGAGTTTACAGTGGCTGTATTCTGCTCGTGGAGACTTCTTCCGTGCTACTTCCAGACTAACAACAGATTTCGGGAATGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EHU093771EHU148581EHU022131
vibrant-m

EHU078971

MISSION® esiRNA

vibrant-m

EHU093771

MISSION® esiRNA

vibrant-m

EHU148581

MISSION® esiRNA

vibrant-m

EHU022131

MISSION® esiRNA

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

Ensembl | human accession no.

ENSG00000072274

Ensembl | human accession no.

ENSG00000003436

Ensembl | human accession no.

ENSG00000198176

Ensembl | human accession no.

ENSG00000129991

esiRNA cDNA target sequence

GGCCAGCAAAGTTGAGAAACTCACTTTAGACAATGCTGCTTTCCCTTTCCTTGCATATTCTGGAATCCCAGCAGTTTCTTTCTGTTTTTGCGAGGACACAGATTATCCTTATTTGGGTACCACCATGGACACCTATAAGGAACTGATTGAGAGGATTCCTGAGTTGAACAAAGTGGCACGAGCAGCTGCAGAGGTCGCTGGTCAGTTCGTGATTAAACTAACCCATGATGTTGAATTGAACCTGGACTATGAGAGGTACAACAGCCAACTGCTTTCATTTGTGAGGGATCTGAACCAATACAGAGCAGACATAAAGGAAATGGGCCTGAGTTTACAGTGGCTGTATTCTGCTCGTGGAGACTTCTTCCGTGCTACTTCCAGACTAACAACAGATTTCGGGAATGC

esiRNA cDNA target sequence

GATACGGAGTTGCCACCACTGAAACTTATGCATTCATTTTGTGCATTCAAGGCGGATGATGGCCCATGTAAAGCAATCATGAAAAGATTTTTCTTCAATATTTTCACTCGACAGTGCGAAGAATTTATATATGGGGGATGTGAAGGAAATCAGAATCGATTTGAAAGTCTGGAAGAGTGCAAAAAAATGTGTACAAGAGATAATGCAAACAGGATTATAAAGACAACATTGCAACAAGAAAAGCCAGATTTCTGCTTTTTGGAAGAAGATCCTGGAATATGTCGAGGTTATATTACCAGGTATTTTTATAACAATCAGACAAAACAGTGTGAACGTTTCAAGTATGGTGGATGCCTGGGCAATATGAACAATTTTGAGACACTGGAAGAATGCAAGAACATTTGTGAAGATGGTCCGAATGGT

esiRNA cDNA target sequence

GGGACCACTTCCTACAACGAAGTGGCAGACGAGCTGGTTGCGGAGTTCAGTGCTGCCGACAACCACATCTTACCAAACGAGTCAGCTTATGACCAGAAAAACATAAGACGGCGCGTCTACGATGCCTTAAACGTGCTAATGGCCATGAACATCATCTCCAAGGAGAAGAAGGAGATCAAGTGGATTGGTCTGCCCACCAACTCGGCTCAGGAATGTCAGAACTTAGAGGTGGAAAGACAGAGGAGACTTGAAAGAATAAAACAGAAACAGTCTCAACTTCAAGAACTTATTCTACAGCAAATTGCCTTCAAGAACCTGGTGCAGAGAAACCGGCATGCGGAGCAGCAGGCCAGCCGGCCACCGCCACCCAACTCAGTCATCCACCTGCCCTTCATCATCGTCAACACCAGCAAGAAGACG

esiRNA cDNA target sequence

TAAGATCTCCGCCTCGAGAAAATTGCAGCTGAAGACTCTGCTGCTGCAGATTGCAAAGCAAGAGCTGGAGCGAGAGGCGGAGGAGCGGCGCGGAGAGAAGGGGCGCGCTCTGAGCACCCGCTGCCAGCCGCTGGAGTTGGCCGGGCTGGGCTTCGCGGAGCTGCAGGACTTGTGCCGACAGCTCCACGCCCGTGTGGACAAGGTGGATGAAGAGAGATACGACATAGAGGCAAAAGTCACCAAGAACATCACGGAGATTGCAGATCTGACTCAGAAGATCTTTGACCTTCGAGGCAAGTTTAAGCGGCCCACCCTGCGGAGAGTGAGGATCTCTGCAGATGCCATGATGCAGGCGCTGCTGGGGGCCCGGGCTAAGGAGTCCCTGGACCTGCGGGCCCACCTCAAGCAGGTGAAGAAGGAGG

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Hongwei Su et al.
Molecular cancer, 18(1), 27-27 (2019-02-21)
Circular RNA (circRNA) represents a broad and diverse endogenous RNAs that can regulate gene expression in cancer. However, the regulation and function of bladder cancer (BC) circRNAs remain largely unknown. Here we generated circRNA microarray data from three BC tissues
Yihe Wu et al.
Thoracic cancer, 9(2), 253-261 (2017-12-30)
Transferrin receptor (TfR) is expressed in most lung cancers and is an indicator of poor prognosis in certain groups of patients. In this study, we blocked cell surface TfR to inhibit lung adenocarcinoma (LAC) cell growth in vitro and investigated
Markus von Nickisch-Rosenegk et al.
Journal of nanobiotechnology, 10, 1-1 (2012-01-10)
The need to functionalize cell membranes in a directed way for specific applications as single cell arrays or to force close cell-to-cell contact for artificial intercellular interaction and/or induction concerning stem cell manipulation or in general to have a tool
Tian Tang et al.
Singapore medical journal, 62(2), 96-103 (2019-11-05)
Dihydroartemisinin (DHA) is a first-line antimalarial drug with relatively low toxicity. DHA has been speculated to possess a broad-spectrum antitumour effect. However, the potential value of DHA for the treatment of endometrial carcinoma or cervical cancer is unclear. We used
K Kobayashi et al.
Clinical and experimental immunology, 199(3), 326-336 (2019-10-30)
Secretory IgA (SIgA) is a well-known mucosal-surface molecule in first-line defense against extrinsic pathogens and antigens. Its immunomodulatory and pathological roles have also been emphasized, but it is unclear whether it plays a pathological role in lung diseases. In the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service