MilliporeSigma
All Photos(1)

Documents

EHU082601

Sigma-Aldrich

MISSION® esiRNA

targeting human EXOSC10

Sign Into View Organizational & Contract Pricing

Select a Size

NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAGATGCAGTGCTTCAAAAGCCACAACCCCAGTTATACAGACCTATAGAAGAGACACCATGCCATTTCATATCCTCCCTGGATGAACTCGTGGAACTCAACGAAAAGCTCTTGAATTGTCAGGAATTTGCAGTTGACTTGGAGCACCACTCTTACAGGAGCTTCCTGGGACTGACCTGCCTGATGCAAATTTCTACTCGGACGGAAGACTTCATCATTGACACCCTCGAGCTTCGAAGTGACATGTACATTCTCAATGAGAGCCTCACAGACCCAGCCATCGTTAAGGTCTTTCATGGTGCTGATTCAGACATAGAATGGCTACAGAAAGACTTTGGGTTGTATGTAGTAAACATGTTTGATACTCATCAGGCAGCACGCCTTCTTAACCTGGGCAGGCACT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EHU114461EHU041641EHU014101
MISSION® esiRNA targeting human EXOSC10

Sigma-Aldrich

EHU082601

MISSION® esiRNA

MISSION® esiRNA targeting human PLXNB1

Sigma-Aldrich

EHU114461

MISSION® esiRNA

MISSION® esiRNA targeting human EXOSC5

Sigma-Aldrich

EHU041641

MISSION® esiRNA

MISSION® esiRNA targeting human EXOSC8

Sigma-Aldrich

EHU014101

MISSION® esiRNA

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

esiRNA cDNA target sequence

GCAGATGCAGTGCTTCAAAAGCCACAACCCCAGTTATACAGACCTATAGAAGAGACACCATGCCATTTCATATCCTCCCTGGATGAACTCGTGGAACTCAACGAAAAGCTCTTGAATTGTCAGGAATTTGCAGTTGACTTGGAGCACCACTCTTACAGGAGCTTCCTGGGACTGACCTGCCTGATGCAAATTTCTACTCGGACGGAAGACTTCATCATTGACACCCTCGAGCTTCGAAGTGACATGTACATTCTCAATGAGAGCCTCACAGACCCAGCCATCGTTAAGGTCTTTCATGGTGCTGATTCAGACATAGAATGGCTACAGAAAGACTTTGGGTTGTATGTAGTAAACATGTTTGATACTCATCAGGCAGCACGCCTTCTTAACCTGGGCAGGCACT

esiRNA cDNA target sequence

GTTCGTGGATGACCTGTTCCAGGTGATTCTCAGCACCAGCCGCCCCGTGCCGCTCGCTGTGAAGTACTTCTTTGACCTGCTGGATGAGCAGGCCCAGCAGCATGGCATCTCCGACCAGGACACCATCCACATCTGGAAGACCAACAGCTTGCCTCTGAGGTTCTGGATCAATATAATAAAAAACCCGCAGTTTGTGTTCGACGTGCAAACATCTGATAACATGGATGCGGTGCTCCTTGTCATTGCACAGACCTTCATGGACGCCTGCACCCTGGCCGACCACAAGCTGGGCCGGGACTCCCCGATCAACAAACTTCTGTATGCACGGGACATTCCCCGGTACAAGCGGATGGTGGAAAGGTACTATGCAGACATCAGACAGACTGTCCCAGCCAGCGACCAAGAGATGAACTCTGTCCTGGCTGAACTGTCCTGGAACTACTCCGGA

esiRNA cDNA target sequence

TCTCTCCTGGCCTGTTGTCTGAATGCCGCCTGCATGGCATTGGTGGATGCAGGTGTGCCCATGCGGGCTCTCTTCTGTGGGGTCGCCTGCGCCCTGGACTCTGATGGGACCCTCGTGCTGGATCCTACATCCAAGCAAGAAAAGGAGGCCCGGGCAGTCCTGACCTTTGCCCTGGACAGCGTGGAACGGAAGCTGCTGATGTCCAGCACCAAGGGGCTCTACTCAGACACTGAGCTCCAGCAGTGCCTGGCTGCGGCCCAGGCCGCTTCGCAACACGTCTTCCGTTTCTACCGGGAATCGCTGCAGAGGCGTTACTCCAAGAGCTGAGGCAAGCTGGGGCAAGGGGCCGCTCCCATTGCCTCCACCCACTCACCCCCTACAGCCTGAAGCAAACCAGCAGCCCAGCCTTGCCTCTCTGACCCATGGGCTCCTTGAGCCTGCAGCTCTGTAACCACAGGGCTCCT

esiRNA cDNA target sequence

AAAGAGAACTGCCGTCCTGATGGAAGAGAACTTGGTGAATTCAGAACCACAACTGTCAACATCGGTTCAATTAGTACCGCAGATGGTTCTGCTTTAGTGAAGTTGGGAAATACTACAGTAATCTGTGGAGTTAAAGCAGAATTTGCAGCACCATCAACAGATGCCCCTGATAAAGGATACGTTGTTCCTAATGTGGATCTACCACCCCTGTGTTCATCGAGATTCCGGTCTGGACCTCCTGGAGAAGAGGCCCAAGTGGCTAGCCAGTTCATTGCAGATGTCATTGAAAATTCACAGATAATTCAGAAAGAGGACTTATGCATTTCTCCAGGAAAGCTTGTCTGGGTTCTATACTGTGATCTCATTTGCCTCGACTACGATGGAAACATTTTGGATGCCTGCACATTTGCTTTGCTAGCGGCTTTAAA

Ensembl | human accession no.

ENSG00000171824

Ensembl | human accession no.

ENSG00000164050

Ensembl | human accession no.

ENSG00000077348

Ensembl | human accession no.

ENSG00000120699

NCBI accession no.

NM_002685

NCBI accession no.

NM_002673

NCBI accession no.

NM_020158

NCBI accession no.

NM_181503

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Lee Davidson et al.
Cell reports, 26(10), 2779-2791 (2019-03-07)
Cell-based studies of human ribonucleases traditionally rely on methods that deplete proteins slowly. We engineered cells in which the 3'→5' exoribonucleases of the exosome complex, DIS3 and EXOSC10, can be rapidly eliminated to assess their immediate roles in nuclear RNA biology.
Karla Rubio et al.
Nature communications, 10(1), 2229-2229 (2019-05-22)
Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive, and highly lethal lung disease with unknown etiology and poor prognosis. IPF patients die within 2 years after diagnosis mostly due to respiratory failure. Current treatments against IPF aim to ameliorate patient
Penelope Kroustallaki et al.
Cell reports, 28(7), 1690-1702 (2019-08-15)
Telomerase biogenesis is a complex process where several steps remain poorly understood. Single-strand-selective uracil-DNA glycosylase (SMUG1) associates with the DKC1-containing H/ACA ribonucleoprotein complex, which is essential for telomerase biogenesis. Herein, we show that SMUG1 interacts with the telomeric RNA component
Dan Vershkov et al.
Cell reports, 26(10), 2531-2539 (2019-03-07)
Fragile X syndrome (FXS) is caused primarily by a CGG repeat expansion in the FMR1 gene that triggers its transcriptional silencing. In order to investigate the regulatory layers involved in FMR1 inactivation, we tested a collection of chromatin modulators for

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service