All Photos(1)

EHU090201

Sigma-Aldrich

MISSION® esiRNA

targeting human KANK1

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCTCCGTGGAAACAAACAGTGTAGGCATCTCCTGCCAGCCTGAATGTAAGAATAAAGTCGTAGGGCCTGAGCTGCCTATGAATTGGTGGATTGTTAAGGAGAGGGTGGAAATGCATGACCGATGTGCTGGGAGGTCTGTGGAAATGTGTGACAAGAGTGTGAGTGTGGAAGTCAGCGTCTGCGAAACAGGCAGCAACACAGAGGAGTCTGTGAACGACCTCACACTCCTCAAGACAAACTTGAATCTCAAAGAAGTGCGGTCTATCGGTTGTGGAGATTGTTCTGTTGACGTGACCGTCTGCTCTCCAAAGGAGTGCGCCTCCCGGGGCGTGAACACTGAGGCTGTTAGCCAGGTGGAAGCTGCCGTCATGGCAGTGCCTCGTACTGCAGACCAGGACACTAGCACAGATTTGGAACAGGTGCACC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Storage Class Code

12 - Non Combustible Liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis

Certificate of Origin

Zhibin Cui et al.
Scientific reports, 7, 40325-40325 (2017-01-10)
Malignant peripheral nerve sheath tumors (MPNSTs) are a type of rare sarcomas with a poor prognosis due to its highly invasive nature and limited treatment options. Currently there is no targeted-cancer therapy for this type of malignancy. Thus, it is
Nisha Bte Mohd Rafiq et al.
Nature materials, 18(6), 638-649 (2019-05-23)
The interrelationship between microtubules and the actin cytoskeleton in mechanoregulation of integrin-mediated adhesions is poorly understood. Here, we show that the effects of microtubules on two major types of cell-matrix adhesion, focal adhesions and podosomes, are mediated by KANK family

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service