MilliporeSigma
All Photos(1)

Documents

EHU090201

Sigma-Aldrich

MISSION® esiRNA

targeting human KANK1

Sign Into View Organizational & Contract Pricing

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCTCCGTGGAAACAAACAGTGTAGGCATCTCCTGCCAGCCTGAATGTAAGAATAAAGTCGTAGGGCCTGAGCTGCCTATGAATTGGTGGATTGTTAAGGAGAGGGTGGAAATGCATGACCGATGTGCTGGGAGGTCTGTGGAAATGTGTGACAAGAGTGTGAGTGTGGAAGTCAGCGTCTGCGAAACAGGCAGCAACACAGAGGAGTCTGTGAACGACCTCACACTCCTCAAGACAAACTTGAATCTCAAAGAAGTGCGGTCTATCGGTTGTGGAGATTGTTCTGTTGACGTGACCGTCTGCTCTCCAAAGGAGTGCGCCTCCCGGGGCGTGAACACTGAGGCTGTTAGCCAGGTGGAAGCTGCCGTCATGGCAGTGCCTCGTACTGCAGACCAGGACACTAGCACAGATTTGGAACAGGTGCACC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EHU007281EHU064221EHU020501
MISSION® esiRNA targeting human KANK1

Sigma-Aldrich

EHU090201

MISSION® esiRNA

MISSION® esiRNA targeting human DDN

Sigma-Aldrich

EHU007281

MISSION® esiRNA

MISSION® esiRNA targeting human GSE1

Sigma-Aldrich

EHU064221

MISSION® esiRNA

MISSION® esiRNA targeting human MESDC2

Sigma-Aldrich

EHU020501

MISSION® esiRNA

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

esiRNA cDNA target sequence

ACCTCCGTGGAAACAAACAGTGTAGGCATCTCCTGCCAGCCTGAATGTAAGAATAAAGTCGTAGGGCCTGAGCTGCCTATGAATTGGTGGATTGTTAAGGAGAGGGTGGAAATGCATGACCGATGTGCTGGGAGGTCTGTGGAAATGTGTGACAAGAGTGTGAGTGTGGAAGTCAGCGTCTGCGAAACAGGCAGCAACACAGAGGAGTCTGTGAACGACCTCACACTCCTCAAGACAAACTTGAATCTCAAAGAAGTGCGGTCTATCGGTTGTGGAGATTGTTCTGTTGACGTGACCGTCTGCTCTCCAAAGGAGTGCGCCTCCCGGGGCGTGAACACTGAGGCTGTTAGCCAGGTGGAAGCTGCCGTCATGGCAGTGCCTCGTACTGCAGACCAGGACACTAGCACAGATTTGGAACAGGTGCACC

esiRNA cDNA target sequence

AACAGTTCGCCAGAGGAAGATGGGAAGACAGCGGAACTGAGCGACAGTGTCGGGGAGATCCTAGATGTCATAAGCCAAACCGAGGAGGTCCTCTTCGGGGTGAGGGACATCAGAGGGACCCAACAGGGAAATAGGAAGAGGCAGTGAGAGGCCCCTTCTTGTATTTGTGTCCCCAACGCATCCATCCTTGGGTCCACTGGTCCCCATTCTTCCCCACAGACTTCCTTTGCTTCTCTTTTCCTTGTATCTTTACCCATACCTGTTCTCATCCTTGAAATATAAATGAAAGGAAGGGAAGCATATGCCCATTAATGATTTTGTTTCAGGAGAGGTGAGAATGAGCAGATTTAATTAATGTCTGTTATGTTCAGGGCACAAGGGTGAGCTCTTCGCAGGGGCTGATGCACTGGGTGTGGAGCTGAGCAGAGAGGCCTA

esiRNA cDNA target sequence

TGAGGAGCCAGAAACAGAAGATGGTCTCAGAAAGGGAGCGGCTCCAGGCAGAACTGGACCACTTACGAAAGTGCCTTGCCTTGCCTGCAATGCACTGGCCTAGGGGCTACCTGAAGGGATATCCCAGGTGACGGTTTCCCTTGCACTAGGCCGAACCTATAGTATAGAAATATTATCTATTTTATTACCTTGAATATTTAATATTTTTCACTGGGAGGTTTGAAGCTTACAAAATGAGAATGTGCCATGCATGAAGCAAAGGATTCCAGGCTCCAGAAAAAATGAATGAACTCACCTTGACGTCAATGCAATTGAATCACCGTTGTCATTCAGCGAGCAACCAATGTAGGATTGCCCACAGTTTTTCTTTTTAAAGGTGGTTTTCGCCCTTCCTCTCCCACATTATTTCTTAATCTGAACATGAAGGCTCCATTAGCAACACTAAAACTTGATCATTAACAGCCCCCTGTG

esiRNA cDNA target sequence

CTCCCCGGAAGAAGAAGAAGGATATTCGCGATTACAATGATGCAGACATGGCGCGTCTTCTGGAGCAATGGGAGAAAGATGATGACATTGAAGAAGGAGATCTTCCAGAGCACAAGAGACCTTCAGCACCTGTCGACTTCTCAAAGATAGACCCAAGCAAGCCTGAAAGCATATTGAAAATGACGAAAAAAGGGAAGACTCTCATGATGTTTGTCACTGTATCAGGAAGCCCTACTGAGAAGGAGACAGAGGAAATTACGAGCCTCTGGCAGGGCAGCCTTTTCAATGCCAACTATGACGTCCAGAGGTTCATTGTGGGATCAGACCGTGCTATCTTCATGCTTCGCGATGGGAGCTACGCCTGGGAGATCAAGGACTTTTTGGTCGGTCAAGACAGGTGTGCTGATGTAACTCTGGAGGGCC

Ensembl | human accession no.

ENSG00000107104

Ensembl | human accession no.

ENSG00000181418

Ensembl | human accession no.

ENSG00000131149

Ensembl | human accession no.

ENSG00000117899

NCBI accession no.

NM_015158

NCBI accession no.

NM_015086

NCBI accession no.

NM_014615

NCBI accession no.

NM_015154

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Zhibin Cui et al.
Scientific reports, 7, 40325-40325 (2017-01-10)
Malignant peripheral nerve sheath tumors (MPNSTs) are a type of rare sarcomas with a poor prognosis due to its highly invasive nature and limited treatment options. Currently there is no targeted-cancer therapy for this type of malignancy. Thus, it is
Nisha Bte Mohd Rafiq et al.
Nature materials, 18(6), 638-649 (2019-05-23)
The interrelationship between microtubules and the actin cytoskeleton in mechanoregulation of integrin-mediated adhesions is poorly understood. Here, we show that the effects of microtubules on two major types of cell-matrix adhesion, focal adhesions and podosomes, are mediated by KANK family

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service