MilliporeSigma
All Photos(1)

EHU090661

Sigma-Aldrich

MISSION® esiRNA

targeting human USP15

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGTGTATCCTGGACCCATTGATAACTCTGGACTTCTCAAAGATGGTGATGCCCAGTCACTTAAGGAACACCTTATTGATGAATTGGATTACATACTGTTGCCAACTGAAGGTTGGAATAAACTTGTCAGCTGGTACACATTGATGGAAGGTCAAGAGCCAATAGCACGAAAGGTGGTTGAACAGGGTATGTTTGTAAAGCACTGCAAAGTAGAAGTATATCTCACAGAATTGAAGCTATGTGAAAATGGAAACATGAATAATGTTGTAACTCGAAGATTTAGCAAAGCTGACACAATAGATACAATTGAAAAGGAAATAAGAAAAATCTTCAGTATTCCAGATGAAAAGGAGACCAGATTGTGGAACAAATACATGAGTAACACATTTGAACCACTGAATAAACCAGACAGCACCATTCAGGATGCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Storage Class Code

12 - Non Combustible Liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis

Enter Lot Number to search for Certificate of Analysis (COA).

Certificate of Origin

Enter Lot Number to search for Certificate of Origin (COO).

Ke Xu et al.
Oncology letters, 15(3), 3846-3851 (2018-02-23)
Glioblastoma multiforme (GBM) is one of the most aggressive types of brain tumor worldwide. Despite the advances made in treatment and research, the median survival time for GBM patients remains <1.5 years, providing impetus for the identification of potential novel
Paul van den Berk et al.
Cell reports, 33(13), 108533-108533 (2020-12-31)
Altering ubiquitination by disruption of deubiquitinating enzymes (DUBs) affects hematopoietic stem cell (HSC) maintenance. However, comprehensive knowledge of DUB function during hematopoiesis in vivo is lacking. Here, we systematically inactivate DUBs in mouse hematopoietic progenitors using in vivo small hairpin RNA (shRNA)
Zhi-Jun Su et al.
Scientific reports, 7, 40246-40246 (2017-01-12)
Hepatitis B virus X protein (HBx) plays important roles in viral replication and the development of hepatocellular carcinoma. HBx is a rapid turnover protein and ubiquitin-proteasome pathway has been suggested to influence HBx stability as treatment with proteasome inhibitors increases

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service