MilliporeSigma
All Photos(1)

Documents

EHU091571

Sigma-Aldrich

MISSION® esiRNA

targeting human CADM1

Sign Into View Organizational & Contract Pricing

NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGTGATGGGCAGAATCTGTTTACGAAAGACGTGACAGTGATCGAGGGAGAGGTTGCGACCATCAGTTGCCAAGTCAATAAGAGTGACGACTCTGTGATTCAGCTACTGAATCCCAACAGGCAGACCATTTATTTCAGGGACTTCAGGCCTTTGAAGGACAGCAGGTTTCAGTTGCTGAATTTTTCTAGCAGTGAACTCAAAGTATCATTGACAAACGTCTCAATTTCTGATGAAGGAAGATACTTTTGCCAGCTCTATACCGATCCCCCACAGGAAAGTTACACCACCATCACAGTCCTGGTCCCACCACGTAATCTGATGATCGATATCCAGAAAGACACTGCGGTGGAAGGTGAGGAGATTGAAGTCAACTGCACTGCTATGGCCAGCAAGCCAGCCACGACTATCAGGTGGTTCAAAGGGAAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EHU051411EHU087181EHU147061
MISSION® esiRNA targeting human CADM1

Sigma-Aldrich

EHU091571

MISSION® esiRNA

MISSION® esiRNA targeting human DICER1

Sigma-Aldrich

EHU051411

MISSION® esiRNA

MISSION® esiRNA targeting human SWAP70

Sigma-Aldrich

EHU087181

MISSION® esiRNA

MISSION® esiRNA targeting human GSPT2

Sigma-Aldrich

EHU147061

MISSION® esiRNA

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

esiRNA cDNA target sequence

GGTGATGGGCAGAATCTGTTTACGAAAGACGTGACAGTGATCGAGGGAGAGGTTGCGACCATCAGTTGCCAAGTCAATAAGAGTGACGACTCTGTGATTCAGCTACTGAATCCCAACAGGCAGACCATTTATTTCAGGGACTTCAGGCCTTTGAAGGACAGCAGGTTTCAGTTGCTGAATTTTTCTAGCAGTGAACTCAAAGTATCATTGACAAACGTCTCAATTTCTGATGAAGGAAGATACTTTTGCCAGCTCTATACCGATCCCCCACAGGAAAGTTACACCACCATCACAGTCCTGGTCCCACCACGTAATCTGATGATCGATATCCAGAAAGACACTGCGGTGGAAGGTGAGGAGATTGAAGTCAACTGCACTGCTATGGCCAGCAAGCCAGCCACGACTATCAGGTGGTTCAAAGGGAAC

esiRNA cDNA target sequence

GCCAGTTGGGAAAGAGACTGTTAAATATGAAGAGGAGCTTGATTTGCATGATGAAGAAGAGACCAGTGTTCCAGGAAGACCAGGTTCCACGAAACGAAGGCAGTGCTACCCAAAAGCAATTCCAGAGTGTTTGAGGGATAGTTATCCCAGACCTGATCAGCCCTGTTACCTGTATGTGATAGGAATGGTTTTAACTACACCTTTACCTGATGAACTCAACTTTAGAAGGCGGAAGCTCTATCCTCCTGAAGATACCACAAGATGCTTTGGAATACTGACGGCCAAACCCATACCTCAGATTCCACACTTTCCTGTGTACACACGCTCTGGAGAGGTTACCATATCCATTGAGTTGAAGAAGTCTGGTTTCATGTTGTCTCTACAAATGCTTGAGTTGATTACAAGACTTCACCAGTATATATTCTCACATATTCTTCGGCTTGAAAAACCTG

esiRNA cDNA target sequence

TTCGCTTTCCATTTCCTGACACTTGACATGGAATGCCTTTGACCATTGGTGCTCTGACAGAGAAGTCATGGAGTCATTGCCATTTCCTGGTTGCCCTTTTGGAATGTGATCCTGTTAGTAGAGGTTTTCTAGCTTCTACTAAGATATTTCTTTCCCTAACCATCATACACTTGGCATGTTTCATTCCCATCTCCTTTCCCCTCACCTTAAAGGAGACTACCCCTTTGCCCCATATTGTCAACCTAATTTTCTCTCGTACTCTCTCTAGTGAATGATGTGCTACCAAGTATATGCCAGGCTGTGAGAGGATTATACTGAGTAGTAGAAAGAAGCTAATTTGAAATAAAAATTATTTGTATAATTAAGAAAGCAGATTAGATGCACATGGTCAACAGGAAGTT

esiRNA cDNA target sequence

CTGCCCTTGGTACACTGGATTACCATTTATTCCGTATTTGGATAACTTGCCAAACTTCAACAGATCAATTGATGGACCAATAAGACTGCCAATTGTGGATAAGTACAAAGATATGGGCACTGTGGTCCTGGGAAAGCTGGAATCCGGGTCCATTTTTAAAGGCCAGCAGCTCGTGATGATGCCAAACAAGCACAATGTAGAAGTTCTTGGAATACTTTCTGATGATACTGAAACTGATTTTGTAGCCCCAGGTGAAAACCTCAAAATCAGACTGAAGGGAATTGAAGAAGAAGAGATTCTTCCAGGATTCATACTTTGTGATCCTAGTAACCTCTGCCATTCTGGACGCACGTTTGATGTTCAGATAGTGATTATTGAGCACAAATCCATCATCTGCCCAGGTTATAATGCGGTGCTGC

Ensembl | human accession no.

ENSG00000182985

Ensembl | human accession no.

ENSG00000100697

Ensembl | human accession no.

ENSG00000133789

Ensembl | human accession no.

ENSG00000189369

NCBI accession no.

NM_014333

NCBI accession no.

NM_030621

NCBI accession no.

NM_015055

NCBI accession no.

NM_018094

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Richard Hunte et al.
PLoS pathogens, 14(4), e1006968-e1006968 (2018-04-27)
Approximately 12% of all human cancers worldwide are caused by infections with oncogenic viruses. Kaposi's sarcoma herpesvirus/human herpesvirus 8 (KSHV/HHV8) is one of the oncogenic viruses responsible for human cancers, including Kaposi's sarcoma (KS), Primary Effusion Lymphoma (PEL), and the
Shu-Jun Wang et al.
Molecular medicine reports, 22(5), 3795-3803 (2020-10-02)
Melanoma is a malignant skin cancer type associated with a high mortality rate, but its treatment is currently not ideal. Both microRNA (miR)‑214 and cell adhesion molecule 1 (CADM1) are differentially expressed in melanoma, but their role in this cancer type
Hye-Ran Kim et al.
Frontiers in immunology, 11, 591054-591054 (2021-02-19)
A robust T-cell response is an important component of sustained antitumor immunity. In this respect, the avidity of TCR in the antigen-targeting of tumors is crucial for the quality of the T-cell response. This study reports that the transmembrane (TM)
Peter J Chockley et al.
The Journal of clinical investigation, 128(4), 1384-1396 (2018-01-13)
During epithelial-mesenchymal transition (EMT) epithelial cancer cells transdifferentiate into highly motile, invasive, mesenchymal-like cells, giving rise to disseminating tumor cells. Few of these disseminated cells successfully metastasize. Immune cells and inflammation in the tumor microenvironment were shown to drive EMT

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service