MilliporeSigma
All Photos(1)

EHU097161

Sigma-Aldrich

MISSION® esiRNA

targeting human DERL3 (1)

NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGTAGGTCTGGAGGCTCGTCACCAACTTCCTCTTCTTCGGGCCCCTGGGATTCAGCTTCTTCTTCAACATGCTCTTCGTGTTCCGCTACTGCCGCATGCTGGAAGAGGGCTCCTTCCGCGGCCGCACGGCCGACTTCGTCTTCATGTTTCTCTTCGGGGGCGTCCTTATGACCCTGCTGGGACTCCTGGGCAGCCTGTTCTTCCTGGGCCAGGCCCTCATGGCCATGCTGGACTCTGGGCTGTGGAGGGTGACCCCACAGTCCGTGGCTGTCTCACAGGGATTGCGGTGGGCCATATCTA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... DERL3(91319)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Storage Class Code

12 - Non Combustible Liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis

Enter Lot Number to search for Certificate of Analysis (COA).

Certificate of Origin

Enter Lot Number to search for Certificate of Origin (COO).

Jinqiang Liu et al.
Archives of oral biology, 118, 104843-104843 (2020-07-28)
The present purpose was to investigate the involvement of Derlin-3 in the endoplasmic reticulum stress pathway-mediated apoptosis of chondrocytes in biomechanically stimulated mandibular condylar cartilage. First, fluid flow shear stress (FFSS) was applied to ATDC5 cells with or without overexpression

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service