MilliporeSigma
All Photos(1)

Documents

EHU097271

Sigma-Aldrich

MISSION® esiRNA

targeting human MCM7

Sign Into View Organizational & Contract Pricing

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGGCACTGAAGGACTACGCGCTAGAGAAGGAAAAGGTTAAGAAGTTCTTACAAGAGTTCTACCAGGATGATGAACTCGGGAAGAAGCAGTTCAAGTATGGGAACCAGTTGGTTCGGCTGGCTCATCGGGAACAGGTGGCTCTGTATGTGGACCTGGACGACGTAGCCGAGGATGACCCCGAGTTGGTGGACTCAATTTGTGAGAATGCCAGGCGCTACGCGAAGCTCTTTGCTGATGCCGTACAAGAGCTGCTGCCTCAGTACAAGGAGAGGGAAGTGGTAAATAAAGATGTCCTGGACGTTTACATTGAGCATCGGCTAATGATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EHU037561EHU012361EHU101391
MISSION® esiRNA targeting human MCM7

EHU097271

MISSION® esiRNA

MISSION® esiRNA targeting human MCM6

EHU037561

MISSION® esiRNA

MISSION® esiRNA targeting human MCM5

EHU012361

MISSION® esiRNA

MISSION® esiRNA targeting human OPA1

EHU101391

MISSION® esiRNA

esiRNA cDNA target sequence

ATGGCACTGAAGGACTACGCGCTAGAGAAGGAAAAGGTTAAGAAGTTCTTACAAGAGTTCTACCAGGATGATGAACTCGGGAAGAAGCAGTTCAAGTATGGGAACCAGTTGGTTCGGCTGGCTCATCGGGAACAGGTGGCTCTGTATGTGGACCTGGACGACGTAGCCGAGGATGACCCCGAGTTGGTGGACTCAATTTGTGAGAATGCCAGGCGCTACGCGAAGCTCTTTGCTGATGCCGTACAAGAGCTGCTGCCTCAGTACAAGGAGAGGGAAGTGGTAAATAAAGATGTCCTGGACGTTTACATTGAGCATCGGCTAATGATG

esiRNA cDNA target sequence

AAACATCTCCGCCAGAGAGATGGTTCTGGAGTGACCAAGTCTTCATGGAGGATTACAGTGCGACAGCTTGAGAGCATGATTCGTCTCTCTGAAGCTATGGCTCGGATGCACTGCTGTGATGAGGTCCAACCTAAACATGTGAAGGAAGCTTTCCGGTTACTGAATAAATCAATCATCCGTGTGGAAACACCTGATGTCAATCTAGATCAAGAGGAAGAGATCCAGATGGAGGTAGATGAGGGTGCTGGTGGCATCAATGGTCATGCTGACAGCCCTGCTCCTGTGAACGGGATCAATGGCTACAATGAAGACATAAATCAAGAGTCTGCTCCCAAAGCCTCCTTAAGGCTGGGCTTCTCTGAGTACTGCCGAATCTCTAACCTTATTGTGCTTCACCTCAGAAAGGTGG

esiRNA cDNA target sequence

CCCATTGGGGTATACACGTCTGGGAAAGGCAGCAGCGCAGCTGGACTGACAGCCTCGGTGATGAGGGACCCTTCGTCCCGGAATTTCATCATGGAGGGCGGAGCCATGGTCCTGGCCGATGGTGGGGTCGTCTGTATTGACGAGTTTGACAAGATGCGAGAAGATGACCGTGTGGCAATCCACGAAGCCATGGAGCAGCAGACCATCTCTATCGCCAAGGCTGGGATCACCACCACCCTGAACTCCCGCTGCTCCGTCCTGGCTGCTGCCAACTCAGTGTTCGGCCGCTGGGATGAGACGAAGGGGGAGGACAACATTGACTTCATGCCCACCATCTTGTCGCGCTTCGACATGATCTTCATCGTCAAGGATGAGCACAATGAGGAGAGGGATGTGATGCTGGCCAAGCATGTCATCACTCTGCACGTGA

esiRNA cDNA target sequence

GGGTTGTTGTGGTTGGAGATCAGAGTGCTGGAAAGACTAGTGTGTTGGAAATGATTGCCCAAGCTCGAATATTCCCAAGAGGATCTGGGGAGATGATGACACGTTCTCCAGTTAAGGTGACTCTGAGTGAAGGTCCTCACCATGTGGCCCTATTTAAAGATAGTTCTCGGGAGTTTGATCTTACCAAAGAAGAAGATCTTGCAGCATTAAGACATGAAATAGAACTTCGAATGAGGAAAAATGTGAAAGAAGGCTGTACCG

Ensembl | human accession no.

ENSG00000166508

Ensembl | human accession no.

ENSG00000076003

Ensembl | human accession no.

ENSG00000100297

Ensembl | human accession no.

ENSG00000198836

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

E P Erkan et al.
Oncogene, 33(39), 4778-4785 (2013-10-30)
Minichromosome maintenance (MCM) proteins are key elements that function as a part of the pre-replication complex to initiate DNA replication in eukaryotes. Consistent with their roles in initiating DNA replication, overexpression of MCM family members has been observed in several
Wenjie Li et al.
Molecular medicine reports, 14(6), 5334-5342 (2016-10-26)
Simvastatin (SIM), a 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibitor, has been reported to inhibit the activity of hepatitis B virus (HBV), however, the mechanism underlying its antiviral function remains unknown. Minichromosome maintenance (MCM) 7, a component of the MCM complex, has been reported to
Kyle M Kovary et al.
Molecular systems biology, 14(5), e7997-e7997 (2018-05-16)
Due to noise in the synthesis and degradation of proteins, the concentrations of individual vertebrate signaling proteins were estimated to vary with a coefficient of variation (CV) of approximately 25% between cells. Such high variation is beneficial for population-level regulation
Xu Zhang et al.
Oncology reports, 33(5), 2599-2605 (2015-03-05)
Human non-small cell lung carcinoma (NSCLC) is one of the most common cancer worldwide. In previous studies, lovastatin, acting as an inhibitor of 3-hydroxy-3-methylglutaryl Co A (HMG-CoA) reductase, exhibited significant antitumor activity during tumorigenesis. However, whether or not this effect

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service