MilliporeSigma
All Photos(1)

Documents

EHU111621

Sigma-Aldrich

MISSION® esiRNA

targeting human TPT1

Sign Into View Organizational & Contract Pricing

Select a Size

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACTCGCTCATTGGTGGAAATGCCTCCGCTGAAGGCCCCGAGGGCGAAGGTACCGAAAGCACAGTAATCACTGGTGTCGATATTGTCATGAACCATCACCTGCAGGAAACAAGTTTCACAAAAGAAGCCTACAAGAAGTACATCAAAGATTACATGAAATCAATCAAAGGGAAACTTGAAGAACAGAGACCAGAAAGAGTAAAACCTTTTATGACAGGGGCTGCAGAACAAATCAAGCACATCCTTGCTAATTTCAAAAACTACCAGTTCTTTATTGGTGAAAACATGAATCCAGATGGCATGGTTGCTCTATTGGACTACCGTGAGGATGGTGTGACCCCATATATGATTTTCTTTAAGGATGGTTTAGAAATGGAAAAATGTTAACAAATGTGGCAATTATTTTGGATCTATCACCTGTCATCATAACTGGCTTCTGCTTGTCATCCACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EHU129911EHU063401EHU013141
MISSION® esiRNA targeting human TPT1

Sigma-Aldrich

EHU111621

MISSION® esiRNA

MISSION® esiRNA targeting human TPR

Sigma-Aldrich

EHU129911

MISSION® esiRNA

MISSION® esiRNA targeting human TPTE

Sigma-Aldrich

EHU063401

MISSION® esiRNA

MISSION® esiRNA targeting human TPI1

Sigma-Aldrich

EHU013141

MISSION® esiRNA

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

esiRNA cDNA target sequence

ACTCGCTCATTGGTGGAAATGCCTCCGCTGAAGGCCCCGAGGGCGAAGGTACCGAAAGCACAGTAATCACTGGTGTCGATATTGTCATGAACCATCACCTGCAGGAAACAAGTTTCACAAAAGAAGCCTACAAGAAGTACATCAAAGATTACATGAAATCAATCAAAGGGAAACTTGAAGAACAGAGACCAGAAAGAGTAAAACCTTTTATGACAGGGGCTGCAGAACAAATCAAGCACATCCTTGCTAATTTCAAAAACTACCAGTTCTTTATTGGTGAAAACATGAATCCAGATGGCATGGTTGCTCTATTGGACTACCGTGAGGATGGTGTGACCCCATATATGATTTTCTTTAAGGATGGTTTAGAAATGGAAAAATGTTAACAAATGTGGCAATTATTTTGGATCTATCACCTGTCATCATAACTGGCTTCTGCTTGTCATCCACA

esiRNA cDNA target sequence

CCAAAGCGTACACGTGAAGAGGAAGAGGATAGCACCATAGAAGCATCAGACCAAGTCTCTGATGATACAGTGGAAATGCCTCTTCCAAAGAAGTTGAAAAGTGTCACACCTGTAGGAACTGAGGAAGAAGTTATGGCAGAAGAAAGTACTGATGGAGAGGTAGAGACTCAGGTATACAACCAGGATTCTCAAGATTCCATTGGAGAAGGAGTTACCCAGGGAGATTATACACCTATGGAAGACAGTGAAGAAACCTCTCAGTCTCTACAAATAGATCTTGGGCCACTTCAATCAGATCAGCAGACGACAACTTCATCCCAGGATGGTCAAGGCAAAGGAGATGATGTCATTGTAATTGACAAGCATGATTATGAAGAGGATGAGGAAGATGATGATGATGATGAAGATGACACAGGGATGGGAGATGAG

esiRNA cDNA target sequence

TCCAGTGATGTTGTAGCTGGATCCGATTAAGTATAGCTCCCCCTTCCCCTTCTGGGAAAGAATTATGTTCTTTCCAACCCTGCCACATGTTCATATATCCTAAATCTATCCTAAATGTTCCTTGAAGTATTTATTTATGTTTATATATGTTTATATATGTTCTTCATAAATCTATTACATATATATAGATAAAATGTCAGTGTCTTTCTTCTTTTTTGAAGGTACATACTTCACAGTTTCCATCTTGTATTTACCTAAATTTGGAACACAGTATGCAGGAACATCAGGCATCATTTTGAAGAACTTTGAAATAGAACTTTCAAAGCAAAAACTTGAGATATTCAAAAATTGTGATTCCCCAACACCCACTTACTTACATATTTTTGGTCAAGTATTTATTCCCTGCTTTGGTTCACA

esiRNA cDNA target sequence

GATGTGGATGGCTTCCTTGTGGGTGGTGCTTCCCTCAAGCCCGAATTCGTGGACATCATCAATGCCAAACAATGAGCCCCATCCATCTTCCCTACCCTTCCTGCCAAGCCAGGGACTAAGCAGCCCAGAAGCCCAGTAACTGCCCTTTCCCTGCATATGCTTCTGATGGTGTCATCTGCTCCTTCCTGTGGCCTCATCCAAACTGTATCTTCCTTTACTGTTTATATCTTCACCCTGTAATGGTTGGGACCAGGCCAATCCCTTCTCCACTTACTATAATGGTTGGAACTAAACGTCACCAAGGTGGCTTCTCCTTGGCTGAGAGATGGAAGGCGTGGTGGGATTTGCTCCTGGGTTCCCTAGGCCCTAGTGAGGGCAGAAGAGAAACCATCCTCTCCCTTCTTACACCGTGAGGCCAAGATCCCCTCAGAAGGCAGGAGTGCTGCCCTCTCCCATGGTGCCCGTGCCTCTGTGCTGTGTATGTGAACCACCCATGTGAGGGAATAAACCTGGCA

Ensembl | human accession no.

ENSG00000133112

Ensembl | human accession no.

ENSG00000047410

Ensembl | human accession no.

ENSG00000166157

Ensembl | human accession no.

ENSG00000111669

NCBI accession no.

NM_003295

NCBI accession no.

NM_003292

NCBI accession no.

NM_199260

NCBI accession no.

NM_000365

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Seong-Yeon Bae et al.
Scientific reports, 5, 8061-8061 (2015-01-28)
Translationally controlled tumor protein (TCTP), is a highly conserved protein involved in fundamental processes, such as cell proliferation and growth, tumorigenesis, apoptosis, pluripotency, and cell cycle regulation. TCTP also inhibits Na,K-ATPase whose subunits have been suggested as a marker of
Ruilin Sun et al.
OncoTargets and therapy, 12, 1641-1653 (2019-03-19)
Lung cancer is the most common and lethal malignancy worldwide. TCTP is highly expressed in various cancers including lung cancer. Epithelial-mesenchymal transition (EMT) could increase cancer cell invasion. Whether TCTP's expression is associated with EMT in lung adenocarcinoma is largely
Jian-Hui Shen et al.
Biotechnology and applied biochemistry, 63(1), 5-14 (2014-12-20)
Osteosarcoma (OS) remains the most frequent primary malignant bone tumor in adolescents. However, the molecular cause of the disease is poorly elucidated. In the present study, we primarily found that translationally controlled tumor protein (TCTP) was overexpressed in human OS
Mari Kaarbø et al.
PloS one, 8(7), e69398-e69398 (2013-07-31)
TCTP has been implicated in a plethora of important cellular processes related to cell growth, cell cycle progression, malignant transformation and inhibition of apoptosis. In addition to these intracellular functions, TCTP has extracellular functions and plays an important role in
Jian Zhang et al.
International journal of biological sciences, 16(14), 2612-2627 (2020-08-15)
MiR-216a-5p has opposite effects on tumorigenesis and progression in the context of different tumors, acting as either a tumor suppressor or an oncogene. However, the expression and function of miR-216a-5p in pancreatic cancer (PC) is not well characterized. In this

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service