EHU112651

Sigma-Aldrich

MISSION® esiRNA

targeting human CXCL1

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTCTTCCGCTCCTCTCACAGCCGCCAGACCCGCCTGCTGAGCCCCATGGCCCGCGCTGCTCTCTCCGCCGCCCCCAGCAATCCCCGGCTCCTGCGAGTGGCACTGCTGCTCCTGCTCCTGGTAGCCGCTGGCCGGCGCGCAGCAGGAGCGTCCGTGGCCACTGAACTGCGCTGCCAGTGCTTGCAGACCCTGCAGGGAATTCACCCCAAGAACATCCAAAGTGTGAACGTGAAGTCCCCCGGACCCCACTGCGCCCAAACCGAAGTCATAGCCACACTCAAGAATGGGCGGAAAGCTTGCCTCAATCCTGCATCCCCCATAGTTAAGAAAATCATCGAAAAGATGCTGAACA

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

storage_class_code

12 - Non Combustible Liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis

Certificate of Origin

Kruttika Bhat et al.
Oncology reports, 38(1), 21-30 (2017-06-01)
Triple negative breast cancer (TNBC) is a subtype of highly aggressive breast cancer with poor prognosis. The main characteristic feature of TNBC is its lack of expression of ER, PR and HER2 receptors that are targets for treatments. Hence, it...
Jing Zhang et al.
Scientific reports, 9(1), 12003-12003 (2019-08-21)
Multiple sclerosis (MS) is a potentially disabling disease of the central nervous system. Approximately half of the patients with MS experience severe pain; however, currently available therapeutics provide only insufficient relief. The mechanisms underlying the generation of neuropathic pain in...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service