MilliporeSigma
All Photos(1)

Documents

EHU121191

Sigma-Aldrich

MISSION® esiRNA

targeting human DES

Sign Into View Organizational & Contract Pricing

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGCTGCAGGAGGAGATTCAGTTGAAGGAAGAAGCAGAGAACAATTTGGCTGCCTTCCGAGCGGACGTGGATGCAGCTACTCTAGCTCGCATTGACCTGGAGCGCAGAATTGAATCTCTCAACGAGGAGATCGCGTTCCTTAAGAAAGTGCATGAAGAGGAGATCCGTGAGTTGCAGGCTCAGCTTCAGGAACAGCAGGTCCAGGTGGAGATGGACATGTCTAAGCCAGACCTCACTGCCGCCCTCAGGGACATCCGGGCTCAGTATGAGACCATCGCGGCTAAGAACATTTCTGAAGCTGAGGAGTGGTACAAGTCGAAGGTGTCAGACCTGACCCAGGCAGCCAACAAGAACAACGACGCCCTGCGCCAGGCCAAGCAGGAGATGATGGAATACCGACACCAGATCCAGTCCTACACCTGCGAGATTGACGCCCTGAAGGGCACTAACGATTCCCTGATGAGGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EHU155881EHU070521EHU112761
MISSION® esiRNA targeting human DES

EHU121191

MISSION® esiRNA

MISSION® esiRNA targeting human DEFA6

EHU155881

MISSION® esiRNA

MISSION® esiRNA targeting human GFRA1

EHU070521

MISSION® esiRNA

MISSION® esiRNA targeting human DNASE1L1

EHU112761

MISSION® esiRNA

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

Gene Information

human ... DES(1674), DES(1674)

Gene Information

human ... DEFA6(1671), DEFA6(1671)

Gene Information

human ... GFRA1(2674), GFRA1(2674)

Gene Information

human ... DNASE1L1(1774), DNASE1L1(1774)

esiRNA cDNA target sequence

AAGCTGCAGGAGGAGATTCAGTTGAAGGAAGAAGCAGAGAACAATTTGGCTGCCTTCCGAGCGGACGTGGATGCAGCTACTCTAGCTCGCATTGACCTGGAGCGCAGAATTGAATCTCTCAACGAGGAGATCGCGTTCCTTAAGAAAGTGCATGAAGAGGAGATCCGTGAGTTGCAGGCTCAGCTTCAGGAACAGCAGGTCCAGGTGGAGATGGACATGTCTAAGCCAGACCTCACTGCCGCCCTCAGGGACATCCGGGCTCAGTATGAGACCATCGCGGCTAAGAACATTTCTGAAGCTGAGGAGTGGTACAAGTCGAAGGTGTCAGACCTGACCCAGGCAGCCAACAAGAACAACGACGCCCTGCGCCAGGCCAAGCAGGAGATGATGGAATACCGACACCAGATCCAGTCCTACACCTGCGAGATTGACGCCCTGAAGGGCACTAACGATTCCCTGATGAGGC

esiRNA cDNA target sequence

TGCTCCTGCTCTCTCTCCTCCAGCGACCCTAGCCATGAGAACCCTCACCATCCTCACTGCTGTTCTCCTCGTGGCCCTCCAGGCCAAGGCTGAGCCACTCCAAGCTGAGGATGATCCACTGCAGGCAAAAGCTTATGAGGCTGATGCCCAGGAGCAGCGTGGGGCAAATGACCAGGACTTTGCCGTCTCCTTTGCAGAGGATGCAAGCTCAAGTCTTAGAGCTTTGGGCTCAACAAGGGCTTTCACTTGCCATTGCAGAAGGTCCTGTTATTCAACAGAATATTCCTATGGGACCTGCACTGTCATGGGTATTAACCACAGATTCTGCTGCCTCTGAGGGATGAGAACAGAGAGAAATATATTCATAATTTACTTTATGACCTAGAAGGAAACTGTCGTGTGTCC

esiRNA cDNA target sequence

GCAACAGTGGGAACGACCTAGAAGAGTGCTTGAAATTTTTGAATTTCTTCAAGGACAATACATGTCTTAAAAATGCAATTCAAGCCTTTGGCAATGGCTCCGATGTGACCGTGTGGCAGCCAGCCTTCCCAGTACAGACCACCACTGCCACTACCACCACTGCCCTCCGGGTTAAGAACAAGCCCCTGGGGCCAGCAGGGTCTGAGAATGAAATTCCCACTCATGTTTTGCCACCGTGTGCAAATTTACAGGCACAGAAGCTGAAATCCAATGTGTCGGGCAATACACACCTCTGTATTTCCAATGGTAATTATGAAAAAGAAGGTCTCGGTGCTTCCAGCCACATAACCACAAAATCAATGGCTGCTCCTCCAAGCTGTGGTCTGAGCCCACTGCTGGTCCTGGTGGTAA

esiRNA cDNA target sequence

CTGCCTGCCTTGTTTGATTTGGCTCTTGTTCTTTGGTTGGGCTTGTGCCTAGATTAGGAGAGGAAGCCAGGGGCCCTGCACTCATGCCACCTGCCAGGTAGTGTAGTATCAGGAGTGGAGACAAAGTGGGCTCTGGGTTGGGGTAGGGGAAGGGAGGGTTCAGAAAGAGGAATGAAGATGTTGTATGACAAGAAGGAAAGTTACTGAGAACAAAAACCCAGATTGGTGAGATAGGACACTTGTGCAGCAGATATGCCAATGGGCCATGTTTATTGTGGATTGGTAAGAATCACCAGGAAACCATTAAGCCCCAATAGCTACAAGGAGGGTGGTTAATCTGCTATATCAAACTCCTTCCCTGAAACCAGCAAACACCGGGAAACATTTTGGCTCATTATAATCCGGTGAACAATGCAGTCAGGCCTGTTATAACCGCTGAGCAGCCACACTCGCACCTCCTGGGTGCTGTAGTCTGTGTTGGTACAGGCTTCTGCATG

NCBI accession no.

NM_001927

NCBI accession no.

NM_001926

NCBI accession no.

NM_145793

NCBI accession no.

NM_006730

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Ji Hyun Kim et al.
Anatomy & cell biology, 46(4), 272-284 (2014-01-05)
Carbonic anhydrase type IX (CA9) is known to express in the fetal joint cartilage to maintain pH against hypoxia. Using paraffin-embedded histology of 10 human fetuses at 10-16 weeks of gestation with an aid of immunohistochemistry of the intermediate filaments
Nobuyuki Hinata et al.
BioMed research international, 2014, 906921-906921 (2014-05-31)
Detailed knowledge of the anatomy of the rhabdosphincter and adjacent tissues is mandatory during urologic surgery to ensure reliable oncologic and functional outcomes. To characterize the levator ani (LA) function for the urethral sphincter, we described connective tissue morphology between
Monica Gunetti et al.
PloS one, 7(9), e45538-e45538 (2012-10-03)
Urinary incontinence, defined as the complaint of any involuntary loss of urine, is a pathological condition, which affects 30% females and 15% males over 60, often following a progressive decrease of rhabdosphincter cells due to increasing age or secondary to
Xiao-Mei Lao et al.
Oncology letters, 11(3), 2027-2034 (2016-03-22)
Inflammation and desmoplasia are frequently identified in the tumor microenvironment, and have been demonstrated to be effective modulators of malignant biological events. However, the mechanisms by which the inflammatory microenvironment and interstitial fibrosis interact with one another remain to be
Tomoyuki Ikeda et al.
Journal of cardiovascular pharmacology, 66(5), 487-496 (2015-08-08)
The effects of chronic blockade of vasopressin type 1a receptors (V1aR) and the additive effects of a type 2 receptor (V2R) antagonist on the treatment of hypertension-induced heart failure and renal injury remain to be unknown. In this study, Dahl

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service