MilliporeSigma
All Photos(1)

Documents

EHU148801

Sigma-Aldrich

MISSION® esiRNA

targeting human YBX1

Sign Into View Organizational & Contract Pricing

NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGAGATGAGACCCAAGGTCAGCAGCCACCTCAACGTCGGTACCGCCGCAACTTCAATTACCGACGCAGACGCCCAGAAAACCCTAAACCACAAGATGGCAAAGAGACAAAAGCAGCCGATCCACCAGCTGAGAATTCGTCCGCTCCCGAGGCTGAGCAGGGCGGGGCTGAGTAAATGCCGGCTTACCATCTCTACCATCATCCGGTTTAGTCATCCAACAAGAAGAAATATGAAATTCCAGCAATAAGAAATGAACAAAAGATTGGAGCTGAAGACCTAAAGTGCTTGCTTTTTGCCCGTTGACCAGATAAATAGAACTATCTGCATTATCTATGCAGCATGGGGTTTTTATTATTTTTACCTAAAGACGTCTCTTTTTGGTAATAACAAACGTGTTTTTTAAAAAAGCCTGGTTTTTCTCAATACGCCTTTAAAGGTTTTTAAATTGTTTCATATCTGGTCAAGTTGAGATTTTTAAGAACTTCATTTTTAATTTGTAATAAAAGTTTACAACTTGATTTTTTCAAAAAAGTCAACAAACTGCAAGCACCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EHU051331EHU023471EHU042331
vibrant-m

EHU148801

MISSION® esiRNA

vibrant-m

EHU051331

MISSION® esiRNA

vibrant-m

EHU023471

MISSION® esiRNA

vibrant-m

EHU042331

MISSION® esiRNA

Ensembl | human accession no.

ENSG00000065978

Ensembl | human accession no.

ENSG00000073969

Ensembl | human accession no.

ENSG00000135318

Ensembl | human accession no.

ENSG00000104805

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

Gene Information

human ... YBX1(4904), YBX1(4904)

Gene Information

human ... NSF(4905), NSF(4905)

Gene Information

human ... NT5E(4907), NT5E(4907)

Gene Information

human ... NUCB1(4924), NUCB1(4924)

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

NCBI accession no.

NM_004559

NCBI accession no.

NM_006178

NCBI accession no.

NM_002526

NCBI accession no.

NM_006184

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Aneri Shah et al.
Cancers, 12(8) (2020-08-09)
Cell fate decisions regulating survival and death are essential for maintaining tissue homeostasis; dysregulation thereof can lead to tumor development. In some cases, survival and death are triggered by the same receptor, e.g., tumor necrosis factor (TNF)-receptor 1 (TNFR1). We
Konstanze Lettau et al.
International journal of radiation oncology, biology, physics, 109(2), 567-580 (2020-09-16)
Y-box binding protein 1 (YB-1) overexpression is associated with chemotherapy- and radiation therapy resistance. Ionizing radiation (IR), receptor tyrosine kinase ligands, and mutation in KRAS gene stimulate activation of YB-1. YB-1 accelerates the repair of IR-induced DNA double-strand breaks (DSBs).
Cristina Pagano et al.
Oncotarget, 8(4), 6193-6205 (2016-12-23)
Correct spatial and temporal control of cell proliferation is of fundamental importance for tissue homeostasis. Its deregulation has been associated with several pathological conditions. In common with almost every aspect of plant and animal biology, cell proliferation is dominated by
Xueming Cao et al.
Free radical biology & medicine, 141, 10-20 (2019-06-04)
Y-box protein 1 (YB1) is a key regulator of inflammatory mediators. However, the roles of YB1 in oxidized low-density lipoprotein (ox-LDL)-induced macrophage inflammation and lipid uptake remain less understood. Thus, we explored the roles of YB1 in ox-LDL-induced macrophage inflammation
Jinjing Jia et al.
Molecular medicine reports, 15(1), 240-248 (2016-12-07)
The cathelicidin antimicrobial peptide, LL-37, is a multifunctional peptide with a broad spectrum of antimicrobial activities, such as chemotaxis and neutralizing endotoxins. Previous studies have demonstrated that it LL‑37 serves a functional role in the development of numerous types of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service