MilliporeSigma
All Photos(1)

Documents

EHU151861

Sigma-Aldrich

MISSION® esiRNA

targeting human VIM

Sign Into View Organizational & Contract Pricing

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTTGAACGCAAAGTGGAATCTTTGCAAGAAGAGATTGCCTTTTTGAAGAAACTCCACGAAGAGGAAATCCAGGAGCTGCAGGCTCAGATTCAGGAACAGCATGTCCAAATCGATGTGGATGTTTCCAAGCCTGACCTCACGGCTGCCCTGCGTGACGTACGTCAGCAATATGAAAGTGTGGCTGCCAAGAACCTGCAGGAGGCAGAAGAATGGTACAAATCCAAGTTTGCTGACCTCTCTGAGGCTGCCAACCGGAACAATGACGCCCTGCGCCAGGCAAAGCAGGAGTCCACTGAGTACCGGAGACAGGTGCAGTCCCTCACCTGTGAAGTGGATGCCCTTAAAGGAACCAATGAGTCCCTGGAACGCCAGATGCGTGAAATGGAAGAGAACTTTGCCGTTGAAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EHU066841EHU034711EHU091521
vibrant-m

EHU151861

MISSION® esiRNA

vibrant-m

EHU066841

MISSION® esiRNA

vibrant-m

EHU034711

MISSION® esiRNA

vibrant-m

EHU091521

MISSION® esiRNA

Ensembl | human accession no.

ENSG00000026025

Ensembl | human accession no.

ENSG00000092820

Ensembl | human accession no.

ENSG00000155959

Ensembl | human accession no.

ENSG00000147852

esiRNA cDNA target sequence

CCTTGAACGCAAAGTGGAATCTTTGCAAGAAGAGATTGCCTTTTTGAAGAAACTCCACGAAGAGGAAATCCAGGAGCTGCAGGCTCAGATTCAGGAACAGCATGTCCAAATCGATGTGGATGTTTCCAAGCCTGACCTCACGGCTGCCCTGCGTGACGTACGTCAGCAATATGAAAGTGTGGCTGCCAAGAACCTGCAGGAGGCAGAAGAATGGTACAAATCCAAGTTTGCTGACCTCTCTGAGGCTGCCAACCGGAACAATGACGCCCTGCGCCAGGCAAAGCAGGAGTCCACTGAGTACCGGAGACAGGTGCAGTCCCTCACCTGTGAAGTGGATGCCCTTAAAGGAACCAATGAGTCCCTGGAACGCCAGATGCGTGAAATGGAAGAGAACTTTGCCGTTGAAGC

esiRNA cDNA target sequence

CCCTCAGATCCCAGTTCCTTTAGAAAGCAGTTACCCAACAGAAACATTCTGGGCTGGGAACCAGGGAGGCGCCCTGGTTTGTTTTCCCCAGTTGTAATAGTGCCAAGCAGGCCTGATTCTCGCGATTATTCTCGAATCACCTCCTGTGTTGTGCTGGGAGCAGGACTGATTGAATTACGGAAAATGCCTGTAAAGTCTGAGTAAGAAACTTCATGCTGGCCTGTGTGATACAAGAGTCAGCATCATTAAAGGAAACGTGGCAGGACTTCCATCTGTGCCATACTTGTTCTGTATTCGAAATGAGCTCAAATTGATTTTTTAATTTCTATGAAGGATCCATCTTTGTATATTTACATGCTTAGAGGGGTGAAAATTATTTTGGAAATTGAGTCTGAAGCACTCTCGCACACACAG

esiRNA cDNA target sequence

AAGGACAGTTGTGGCAAAGGAGAAATGGCCACAGGGAATGGGCGGCGGCTCCACCTGGGGATTCCTGAGGCCGTGTTTGTGGAAGATGTAGATTCCTTCATGAAACAGCCTGGGAATGAGACTGCAGATACAGTATTAAAGAAGCTGGATGAACAGTACCAGAAGTATAAGTTTATGGAACTCAACCTTGCTCAAAAGAAAAGAAGGCTAAAAGGTCAGATTCCTGAAATTAAACAGACTTTGGAAATTCTAAAATACATGCAGAAGAAAAAAGAGTCCACCAACTCAATGGAGACCAGATTCTTGCTGGCAGATAACCTGTATTGCAAAGCTTCAGTTCCTCCTACCGATAAAATGTGTCTGTGGTTGGGGGCTAATGTAATGCTTGAATATGATATTGATGAAGCTCAGGCATTGTTGGAAAAGAATTTATCGACTGCCACAAAGAATCTTGATTCCCTGGAGGAAGACCT

esiRNA cDNA target sequence

TCCAGGAATCTGCAGTCAAATTTGTATCAACTTAAAAGGCGGTTACAAGTGTGAATGTAGTCGTGGCTATCAAATGGATCTTGCTACTGGCGTGTGCAAGGCAGTAGGCAAAGAGCCAAGTCTGATCTTCACTAATCGAAGAGACATCAGGAAGATTGGCTTAGAGAGGAAAGAATATATCCAACTAGTTGAACAGCTAAGAAACACTGTGGCTCTCGATGCTGACATTGCTGCCCAGAAACTATTCTGGGCCGATCTAAGCCAAAAGGCTATCTTCAGTGCCTCAATTGATGACAAGGTTGGTAGACATGTTAAAATGATCGACAATGTCTATAATCCTGCAGCCATTGCTGTTGATTGGGTGTACAAGACCATCTACTGGACTGATGCGGCTTCTAAG

Gene Information

human ... VIM(7431), VIM(7431)

Gene Information

human ... EZR(7430), VIL2(7430)

Gene Information

human ... VBP1(7411), VBP1(7411)

Gene Information

human ... VLDLR(7436), VLDLR(7436)

NCBI accession no.

NM_003380

NCBI accession no.

NM_003379

NCBI accession no.

NM_003372

NCBI accession no.

NM_001018056

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Wei Wu et al.
Virology, 497, 41-52 (2016-07-17)
Influenza A virus exploits the subcellular transport machinery during the early stages of infection. Actin filaments and microtubules facilitate the trafficking of virus-containing endosomes towards the perinuclear region; however, the role of vimentin remains to be determined. In this study
Brian Koons et al.
ACS nano, 11(12), 12037-12048 (2017-11-17)
Cell migration is studied with the traditional focus on protrusion-driven cell body displacement, while less is known on morphodynamics of individual protrusions themselves, especially in fibrous environments mimicking extracellular matrix. Here, using suspended fibers, we report integrative and multiscale abilities
Alison E Patteson et al.
Small (Weinheim an der Bergstrasse, Germany), 15(50), e1903180-e1903180 (2019-11-14)
The migration of cells through constricting spaces or along fibrous tracks in tissues is important for many biological processes and depends on the mechanical properties of a cytoskeleton made up of three different filaments: F-actin, microtubules, and intermediate filaments. The
Shih-Hung Chan et al.
Oncotarget, 8(25), 41364-41378 (2017-05-11)
The association between metabolic diseases and the risk of developing cancer is emerging. However, the impact of long pentraxin-3 (PTX3) on dyslipidemia-associated tumor metastasis remains unknown. In this study, we found that oleate induced PTX3 expression and secretion through the
Fu Jun Li et al.
American journal of physiology. Lung cellular and molecular physiology, 313(1), L80-L91 (2017-04-30)
Exposure to cadmium (Cd) has been associated with development of chronic obstructive lung disease (COPD). The mechanisms and signaling pathways whereby Cd causes pathological peribronchiolar fibrosis, airway remodeling, and subsequent airflow obstruction remain unclear. We aimed to evaluate whether low-dose

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service