MilliporeSigma
All Photos(1)

Documents

EHU159631

Sigma-Aldrich

MISSION® esiRNA

targeting human CXCL9

Sign Into View Organizational & Contract Pricing

Select a Size

NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGTTGTCTGTGGCCAGAATTTAAACCTATACTCACTTTCCCAAATTGAATCACTGCTCACACTGCTGATGATTTAGAGTGCTGTCCGGTGGAGATCCCACCCGAACGTCTTATCTAATCATGAAACTCCCTAGTTCCTTCATGTAACTTCCCTGAAAAATCTAAGTGTTTCATAAATTTGAGAGTCTGTGACCCACTTACCTTGCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EHU112651EHU098761EHU148711
MISSION® esiRNA targeting human CXCL9

Sigma-Aldrich

EHU159631

MISSION® esiRNA

MISSION® esiRNA targeting human CXCL1

Sigma-Aldrich

EHU112651

MISSION® esiRNA

MISSION® esiRNA targeting human MFAP3

Sigma-Aldrich

EHU098761

MISSION® esiRNA

MISSION® esiRNA targeting human FRG1

Sigma-Aldrich

EHU148711

MISSION® esiRNA

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

esiRNA cDNA target sequence

AGGTTGTCTGTGGCCAGAATTTAAACCTATACTCACTTTCCCAAATTGAATCACTGCTCACACTGCTGATGATTTAGAGTGCTGTCCGGTGGAGATCCCACCCGAACGTCTTATCTAATCATGAAACTCCCTAGTTCCTTCATGTAACTTCCCTGAAAAATCTAAGTGTTTCATAAATTTGAGAGTCTGTGACCCACTTACCTTGCA

esiRNA cDNA target sequence

CTCTTCCGCTCCTCTCACAGCCGCCAGACCCGCCTGCTGAGCCCCATGGCCCGCGCTGCTCTCTCCGCCGCCCCCAGCAATCCCCGGCTCCTGCGAGTGGCACTGCTGCTCCTGCTCCTGGTAGCCGCTGGCCGGCGCGCAGCAGGAGCGTCCGTGGCCACTGAACTGCGCTGCCAGTGCTTGCAGACCCTGCAGGGAATTCACCCCAAGAACATCCAAAGTGTGAACGTGAAGTCCCCCGGACCCCACTGCGCCCAAACCGAAGTCATAGCCACACTCAAGAATGGGCGGAAAGCTTGCCTCAATCCTGCATCCCCCATAGTTAAGAAAATCATCGAAAAGATGCTGAACA

esiRNA cDNA target sequence

GGCAGCATTTTTCCTCTCTGATACTTTTCAGTCATTTTCCTTAGAGCTTTATTAAATTATGCATGCTAAGATTTAAAGGAGCCCCAGATAAACATGATGGGGAAAAGCACTGAACTAAGAGTCCCATGGTTTCTCTTCTGGTCACAGTTCTTCCATTGGTTGGATCTGATACTTATCTTGGGACTTCAGTTTTTCCGTCAATAAGATGAGGGATTAGGTGAGATCTGAAGTTGTTTCTAGCTCTATAGCTTCTTAACCCATCACCTTTAAATTACCAGAATCTTCACTCATCTCTAAGTAAACCTTTCCCGGGACTTT

esiRNA cDNA target sequence

CAAGGGAACCAAGACGAAGAGTAAGAAGAAAAAGAGCAAAGATAAGAAAAGAAAAAGAGAAGAAGATGAAGAAACCCAGCTTGATATTGTTGGAATCTGGTGGACAGTAACAAACTTTGGTGAAATTTCAGGAACCATAGCCATTGAAATGGATAAGGGAACCTATATACATGCACTCGACAATGGTCTTTTTACCCTGGGAGCTCCACACAAAGAAGTTGATGAGGGCCCTAGTCCTCCAGAGCAGTTTACGGCTGTCAAATTATCTGATTCCAGAATCGCCCTGAAGTCTGGCTATGGAAAATATCTTGGTATAAATTCAGATGGACTTGTTGTTGGGCGTTCAGATGCAATTGGACCAAGAGAACAATGGGAACCAGTCTTTCAAAATGGGAAAATGGCTTTGTTGGCCTCAAATAGCTGCTTTATTAGATGCAATGAAGCAGGGGACATAGAAGCA

Ensembl | human accession no.

ENSG00000138755

Ensembl | human accession no.

ENSG00000163739

Ensembl | human accession no.

ENSG00000037749

Ensembl | human accession no.

ENSG00000109536

NCBI accession no.

NM_002416

NCBI accession no.

-

NCBI accession no.

NM_005927

NCBI accession no.

NM_004477

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Zezheng Liu et al.
Clinical interventions in aging, 15, 1201-1212 (2020-08-09)
Estrogen deficiency leads to bone loss in postmenopausal osteoporosis, because bone formation, albeit enhanced, fails to keep pace with the stimulated osteoclastic bone resorption. The mechanism driving this uncoupling is central to the pathogenesis of postmenopausal osteoporosis, which, however, remains

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service