MilliporeSigma
All Photos(1)

EHU900911

Sigma-Aldrich

MISSION® esiRNA

targeting human GNB1L (2)

form

lyophilized
lyophilized powder

esiRNA cDNA target sequence

ACTCCGTGTGCTTGGAGAGTGTGGGCTTCTGCCGGAGCAGCATCCTGGCCGGGGGCCAGCCACGCTGGACGCTTGCCGTGCCAGGGAGGGGCAGCGACGAGGTTCAGATTCTGGAGATGCCCTCCAAGACGTCAGTGTGCGCCCTGAAGCCGAAGGCAGATGCCAAGCTGGGCATGCCCATGTGCCTGCGGCTGTGGCAGGCCGACTGCAGCTCCCGCCCACTCCTTCTGGCCGGCTATGAGGATGGATCGGTGGTCCTGTGGGACGTCTCTGAGCAGAAGGTGTGCAGCCGCATCGCCTGCCATGAGGAGCCCGTCATGGACCTTGACTTTGACTCCCAGAAGGCC

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... GNB1L(54584)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

Storage Class Code

11 - Combustible Solids

WGK

WGK 1

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis

Enter Lot Number to search for Certificate of Analysis (COA).

Certificate of Origin

Enter Lot Number to search for Certificate of Origin (COO).

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service