MilliporeSigma
All Photos(1)

Documents

EMU018761

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Furin

Sign Into View Organizational & Contract Pricing

Select a Size

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGAGCCAAGAGGGACGTGTATCAGGAGCCCACGGACCCCAAGTTCCCCCAGCAGTGGTACCTGTCTGGTGTCACTCAGCGAGACCTGAATGTGAAGGAGGCCTGGGCCCAGGGCTTCACAGGCCATGGCATTGTGGTCTCCATCCTGGATGACGGCATTGAGAAGAATCATCCCGACCTAGCAGGCAATTATGACCCTGGAGCCAGTTTTGACGTGAATGACCAGGACCCCGACCCACAGCCTCGGTACACACAGATGAATGACAACAGGCATGGCACTCGCTGTGCCGGGGAAGTGGCAGCAGTGGCCAACAATGGTGTCTGTGGCGTAGGTGTAGCTTACAATGCCCGAATTGGAGGGGTGCGGATGTTGGATGGCGAGGTGACTGATGCAGTAGAGGCACGTTCGCTGGGCCTGAATCCCAACCACATCCACAT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EMU041741EMU012721EMU091471
MISSION® esiRNA targeting mouse Furin

Sigma-Aldrich

EMU018761

MISSION® esiRNA

MISSION® esiRNA targeting mouse Pdgfa

Sigma-Aldrich

EMU041741

MISSION® esiRNA

MISSION® esiRNA targeting mouse Npm3

Sigma-Aldrich

EMU012721

MISSION® esiRNA

MISSION® esiRNA targeting mouse Pnp1

Sigma-Aldrich

EMU091471

MISSION® esiRNA

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

esiRNA cDNA target sequence

AGAGCCAAGAGGGACGTGTATCAGGAGCCCACGGACCCCAAGTTCCCCCAGCAGTGGTACCTGTCTGGTGTCACTCAGCGAGACCTGAATGTGAAGGAGGCCTGGGCCCAGGGCTTCACAGGCCATGGCATTGTGGTCTCCATCCTGGATGACGGCATTGAGAAGAATCATCCCGACCTAGCAGGCAATTATGACCCTGGAGCCAGTTTTGACGTGAATGACCAGGACCCCGACCCACAGCCTCGGTACACACAGATGAATGACAACAGGCATGGCACTCGCTGTGCCGGGGAAGTGGCAGCAGTGGCCAACAATGGTGTCTGTGGCGTAGGTGTAGCTTACAATGCCCGAATTGGAGGGGTGCGGATGTTGGATGGCGAGGTGACTGATGCAGTAGAGGCACGTTCGCTGGGCCTGAATCCCAACCACATCCACAT

esiRNA cDNA target sequence

CAAGACCAGGACGGTCATTTACGAGATACCTCGGAGCCAGGTGGACCCCACATCGGCCAACTTCCTGATCTGGCCCCCATGTGTGGAGGTGAAGCGCTGCACTGGCTGTTGTAACACCAGCAGCGTCAAGTGCCAGCCTTCACGGGTCCACCACCGCAGTGTCAAGGTGGCCAAAGTGGAGTATGTCAGGAAGAAGCCAAAATTGAAAGAGGTCCAGGTGAGGTTAGAGGAACACCTGGAGTGTGCATGTGCGACCTCCAACCTGAACCCAGACCATCGGGAGGAGGAGACAGATGTGAGGTGAGATGAGCCGGCCGCCCTCTCCCGGGACACGGATGTGCGTGGCGTGTGACATTCCTGAACATACTATGTATGGTGCTTCATTGCCAATGTGCGTGCGGTCTTTGTTCTCCTCCGTGAAAAACTGTGTCCGAGGACAAAGAGACAGTGTCCGTTTGTTCAGTGTGACATCAAAGCAAGTACTGTAGCACTCAGAGAGACAGTGAGAAAGCTTCCTTGTCACAGAGAGCGA

esiRNA cDNA target sequence

GGTTGAGGAGGAGGATGACACGGAGCACGTGCTGGCGTTGAACATGCTGTGCCTTACCGAGGGGGCCACGGACGAGTGTAATGTGGTGGAAGTTGTGGCCCGGGATCACGACAATCAGGAGATTGCAGTTCCTGTGGCCAACCTCAGGTTGTCTTGCCAGCCCATGCTCAGTGTGGATGATTTCCAACTCCAACCACCTGTCACCTTCCGCCTGAAGTCCGGTTCTGGCCCAGTTCGGATCACTGGCCGGCATCAGATCGTTTGTATAAACAACGACCTTTCTGAAGAAGAAAGTGATGATGAGAGCGAAGAAGATGAAATTAAGCTGTGTGGCATCCTTCCTGCCAAGAAGCACAGGGGCAGGCCTTAGCCCCCTGATCAGGTAACTGCTTGCTACAGGTGCCATGCTCCGTATGTTCCTGGA

esiRNA cDNA target sequence

AGTTATCGTCGCAAGGCACTGTGGGCTCCGTGTCTTTGGTTTCTCACTCATTACGAACAAGGTTGTCATGGATTATGAGAACTTGGAGAAGGCCAATCACATGGAAGTTCTGGATGCCGGGAAAGCAGCTGCACAGACATTGGAAAGGTTTGTCTCCATTCTTATGGAGAGCATTCCACTCCCGGATCGTGGCAGCTGACCTGCAATGGAGTGCTCCGCTGCTCCCCTGGTGGGGTCCAAGTAGCTCTCTACTCTGTTTCCTTGATGAAGTCACTAGTCTCTGTTCTTAGATCCTAGCAGAAAGGAAAGAGGAGCTTACCCTTCACTTTCCAGATGTTGTTCTACTGTTCTAATGCCCAGTCTTCTTGCTTAGTTGCCTTCTCAAATTAACTTTCATTCCTCTGGAAGAGCTGG

Ensembl | mouse accession no.

ENSMUSG00000030530

Ensembl | mouse accession no.

ENSMUSG00000025856

Ensembl | mouse accession no.

ENSMUSG00000056209

Ensembl | mouse accession no.

ENSMUSG00000021871

NCBI accession no.

NP_001074923

NCBI accession no.

NP_032834

NCBI accession no.

NM_008723

NCBI accession no.

NM_013632

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Diana Farhat et al.
British journal of cancer, 122(6), 885-894 (2020-01-29)
Breast cancer is the second most common cancer in the world. Despite advances in therapies, the mechanisms of resistance remain the underlying cause of morbidity and mortality. Lipoic acid (LA) is an antioxidant and essential cofactor in oxidative metabolism. Its
Z Zhou et al.
Cell death & disease, 4, e593-e593 (2013-04-20)
The multinucleated syncytial trophoblast, which forms the outermost layer of the placenta and serves multiple functions, is differentiated from and maintained by cytotrophoblast cell fusion. Deficiencies in syncytial trophoblast differentiation or maintenance likely contribute to intrauterine growth restriction and pre-eclampsia
Xiaokui Yang et al.
PloS one, 8(2), e50479-e50479 (2013-02-19)
Folliculogenesis is tightly controlled by a series of hormones, growth factors and cytokines, many of which are secreted as proproteins and require processing by proteases before becoming functional. Furin is a member of the subtilisin-like proteases that activate large numbers
Jian Shang et al.
Proceedings of the National Academy of Sciences of the United States of America, 117(21), 11727-11734 (2020-05-08)
A novel severe acute respiratory syndrome (SARS)-like coronavirus (SARS-CoV-2) is causing the global coronavirus disease 2019 (COVID-19) pandemic. Understanding how SARS-CoV-2 enters human cells is a high priority for deciphering its mystery and curbing its spread. A virus surface spike
Jian Fu et al.
Molecular carcinogenesis, 54(9), 698-706 (2014-01-18)
Proprotein convertases (PC), a family of serine proteases, process cancer-related substrates such as growth factors, growth factor receptors, cell adhesion molecules, metalloproteinases, etc. HIF-1α is a major transcription factor involved in tumorigenesis by sensing intratumoral hypoxia. Furin (PCSK3) is one

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service