MilliporeSigma
All Photos(1)

Documents

EMU028161

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cdc2a

Sign Into View Organizational & Contract Pricing

Select a Size

NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACGAATCTCTGGCAAAATGGCCCTGAAGCACCCGTACTTTGATGACTTGGACAATCAGATTAAGAAGATGTAGCCCTCTGGATGGATGTCCCTGTCTGCTGGTCGTAGGGGAAGATCGTGTTGTTTACCGTTGGCTCTCTTCCTGTCTTGTATAGTTTTCTTTGTTTGTAAACTGTCATCTGGACTTTTCTTAATTTCCTACGTATAACTTAATTAACATGTAAATATTATTCCATATGAATTTAAATATAATTCTGTATATGTGCAGATGTCACTGTGGTGGCTGTTAATTACTATAACACAAGTGTTAATTACTACAACATAAGACTTGAGTCTCCCTAGACTTCCCAGCAGCCATTCCTGCAGCTCGGAGCACAGTTGAAGGAGCTGAGCTCAGGCCTCGTGATGCTTTCAAGTGCCTCCGTGTTCTGGATATATATGATTCCTGGTCAGTTTCTTGCC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EMU084531EMU057631EMU015831
MISSION® esiRNA targeting mouse Cdc2a

Sigma-Aldrich

EMU028161

MISSION® esiRNA

MISSION® esiRNA targeting mouse Cdc2l1

Sigma-Aldrich

EMU084531

MISSION® esiRNA

MISSION® esiRNA targeting mouse Cdc20

Sigma-Aldrich

EMU057631

MISSION® esiRNA

MISSION® esiRNA targeting mouse Col6a2

Sigma-Aldrich

EMU015831

MISSION® esiRNA

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

esiRNA cDNA target sequence

ACGAATCTCTGGCAAAATGGCCCTGAAGCACCCGTACTTTGATGACTTGGACAATCAGATTAAGAAGATGTAGCCCTCTGGATGGATGTCCCTGTCTGCTGGTCGTAGGGGAAGATCGTGTTGTTTACCGTTGGCTCTCTTCCTGTCTTGTATAGTTTTCTTTGTTTGTAAACTGTCATCTGGACTTTTCTTAATTTCCTACGTATAACTTAATTAACATGTAAATATTATTCCATATGAATTTAAATATAATTCTGTATATGTGCAGATGTCACTGTGGTGGCTGTTAATTACTATAACACAAGTGTTAATTACTACAACATAAGACTTGAGTCTCCCTAGACTTCCCAGCAGCCATTCCTGCAGCTCGGAGCACAGTTGAAGGAGCTGAGCTCAGGCCTCGTGATGCTTTCAAGTGCCTCCGTGTTCTGGATATATATGATTCCTGGTCAGTTTCTTGCC

esiRNA cDNA target sequence

GTGGCTCTGAAGCGGTTAAAGATGGAGAAGGAGAAGGAAGGCTTCCCAATCACGTCGCTGAGGGAAATCAACACCATCCTCAAGGCCCAGCACCCCAACATCGTCACCGTCAGGGAAATTGTTGTGGGAAGTAACATGGACAAGATCTACATTGTGATGAACTACGTGGAACATGACCTCAAGAGCCTAATGGAGACCATGAAGCAGCCCTTCCTGCCAGGGGAGGTGAAGACCCTGATGATTCAGCTGCTGAGTGGGGTAAAGCACCTCCATGACAATTGGATCCTACACCGTGACCTGAAGACCTCTAACCTCCTGCTGAGCCATGCTGGCATTCTCAAGGTGGGCGACTTTGGGCTGGCTCGGGAGTATGGTTCACCCCTAAAGGCCTACACTCCAGTTGTTGTAACCCTGTGGTATCGTGCCCCAGAACTACTGCTTGGTGCTAAGGAATACTCCACAGCTGTGGACATGTGGTCGGTAGGCTGCATAT

esiRNA cDNA target sequence

CCCAGAAGGCTACCAGAACAGACTGAAAGTACTGTACAGTCAGAAAGCCACGCCTGGCTCCAGCAGGAAGACTTGCAGATACATCCCTTCTCTGCCAGACAGGATCCTTGATGCCCCCGAAATCCGGAATGACTACTACCTGAATCTTGTAGATTGGAGCTCTGGAAATGTATTGGCTGTGGCACTGGACAACAGTGTGTACTTATGGAACGCTGGTTCTGGTGACATCCTGCAGTTGTTGCAAATGGAGCAGCCTGGAGACTACATATCCTCGGTGGCCTGGATCAAGGAGGGCAACTACCTAGCTGTAGGCACCAGCAATGCTGAGGTCCAGCTCTGGGATGTGCAGCAGCAGAAACGACTTCGAAACATGACCAGTCACTCCGCTCGAGTAAGCTCCCTCAGTTGGAACAGCTATATCCTATCCAGTGGTTCACGGTCTGGCCACATCCACCACCATGATGTTCGGGTAGCAGAACACCATGTGGCCACACTGAGTGGCCATAGCCAGGAAGTATGTGGGC

esiRNA cDNA target sequence

CAAGGACCCCAAGTCAGAAACAGGCACACGTGTGGGTGTGGTGCAGTACAGCCACGAGGGCACCTTTGAGGCCATCCGGCTGGACGACGAGCGAGTCAACTCCCTGTCTAGTTTCAAGGAGGCTGTCAAAAACCTTGAATGGATCGCCGGTGGCACTTGGACGCCCTCTGCCCTCAAGTTTGCCTATAATCAGCTCATCAAAGAAAGCCGGCGCCAGAAGACCCGGGTGTTCGCAGTGGTCATCACGGATGGGCGCCATGACCCCCGAGATGATGACCTCAATCTTCGGGCACTGTGTGACCGAGATGTCACTGTGACAGCCATTGGCATCGGTGACATGTTCCACGAGACTCATGAGAGTGAGAACCTCTACTCCATTGCCTGTGACAAGCCACAGCAAGTGCGCAACATGACGCTGTTCTCTGACCTG

Ensembl | mouse accession no.

ENSMUSG00000019942

Ensembl | mouse accession no.

ENSMUSG00000029062

Ensembl | mouse accession no.

ENSMUSG00000006398

Ensembl | mouse accession no.

ENSMUSG00000020241

NCBI accession no.

NP_031685

NCBI accession no.

NP_031687

NCBI accession no.

NM_023223

NCBI accession no.

NM_146007

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Documents related to the products that you have purchased in the past have been gathered in the Document Library for your convenience.

Visit the Document Library

Difficulty Finding Your Product Or Lot/Batch Number?

Product numbers are combined with Pack Sizes/Quantity when displayed on the website (example: T1503-25G). Please make sure you enter ONLY the product number in the Product Number field (example: T1503).

Example:

T1503
Product Number
-
25G
Pack Size/Quantity

Additional examples:

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

enter as 1.000309185)

Having trouble? Feel free to contact Technical Service for assistance.

Lot and Batch Numbers can be found on a product's label following the words 'Lot' or 'Batch'.

Aldrich Products

  • For a lot number such as TO09019TO, enter it as 09019TO (without the first two letters 'TO').

  • For a lot number with a filling-code such as 05427ES-021, enter it as 05427ES (without the filling-code '-021').

  • For a lot number with a filling-code such as STBB0728K9, enter it as STBB0728 without the filling-code 'K9'.

Not Finding What You Are Looking For?

In some cases, a COA may not be available online. If your search was unable to find the COA you can request one.

Request COA

Griselda Vallejo et al.
PloS one, 9(5), e97311-e97311 (2014-05-27)
Although non-genomic steroid receptor pathways have been studied over the past decade, little is known about the direct gene expression changes that take place as a consequence of their activation. Progesterone controls proliferation of rat endometrial stromal cells during the
Gunjan Guha et al.
PloS one, 10(5), e0125322-e0125322 (2015-05-06)
Pactamycin, although putatively touted as a potent antitumor agent, has never been used as an anticancer drug due to its high cytotoxicity. In this study, we characterized the effects of two novel biosynthetically engineered analogs of pactamycin, de-6MSA-7-demethyl-7-deoxypactamycin (TM-025) and
Qing Xia et al.
International journal of oncology, 44(3), 735-744 (2014-01-01)
Breast cancer is one of the most common malignancies in women. Approximately 15% of the patients belong to the triple-negative breast cancer (TNBC) group, and have the disadvantage of not benefiting from currently available receptor-targeted systemic therapies. Some cancers in
Qinghua Xi et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(7), 4939-4948 (2015-04-26)
Overexpression of cyclin-dependent kinase 1 (CDK1) has been noted to correlation with several human cancers. However, the effects of CDK1 on ovarian cancer development remain unclear. The aim of this study was to examine the effect of CDK1 and related

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service