EMU028161

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cdc2a

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACGAATCTCTGGCAAAATGGCCCTGAAGCACCCGTACTTTGATGACTTGGACAATCAGATTAAGAAGATGTAGCCCTCTGGATGGATGTCCCTGTCTGCTGGTCGTAGGGGAAGATCGTGTTGTTTACCGTTGGCTCTCTTCCTGTCTTGTATAGTTTTCTTTGTTTGTAAACTGTCATCTGGACTTTTCTTAATTTCCTACGTATAACTTAATTAACATGTAAATATTATTCCATATGAATTTAAATATAATTCTGTATATGTGCAGATGTCACTGTGGTGGCTGTTAATTACTATAACACAAGTGTTAATTACTACAACATAAGACTTGAGTCTCCCTAGACTTCCCAGCAGCCATTCCTGCAGCTCGGAGCACAGTTGAAGGAGCTGAGCTCAGGCCTCGTGATGCTTTCAAGTGCCTCCGTGTTCTGGATATATATGATTCCTGGTCAGTTTCTTGCC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... CDC2A(12534), Cdc2a(12534)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit
SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin
Griselda Vallejo et al.
PloS one, 9(5), e97311-e97311 (2014-05-27)
Although non-genomic steroid receptor pathways have been studied over the past decade, little is known about the direct gene expression changes that take place as a consequence of their activation. Progesterone controls proliferation of rat endometrial stromal cells during the...
Gunjan Guha et al.
PloS one, 10(5), e0125322-e0125322 (2015-05-06)
Pactamycin, although putatively touted as a potent antitumor agent, has never been used as an anticancer drug due to its high cytotoxicity. In this study, we characterized the effects of two novel biosynthetically engineered analogs of pactamycin, de-6MSA-7-demethyl-7-deoxypactamycin (TM-025) and...
Qinghua Xi et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(7), 4939-4948 (2015-04-26)
Overexpression of cyclin-dependent kinase 1 (CDK1) has been noted to correlation with several human cancers. However, the effects of CDK1 on ovarian cancer development remain unclear. The aim of this study was to examine the effect of CDK1 and related...
Qing Xia et al.
International journal of oncology, 44(3), 735-744 (2014-01-01)
Breast cancer is one of the most common malignancies in women. Approximately 15% of the patients belong to the triple-negative breast cancer (TNBC) group, and have the disadvantage of not benefiting from currently available receptor-targeted systemic therapies. Some cancers in...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

MilliporeSigma

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.