Skip to Content
MilliporeSigma

EMU086861

MISSION® esiRNA

targeting mouse Hdac2

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TATTATGGCCAGGGTCATCCCATGAAGCCTCATAGAATCCGGATGACTCATAACTTGCTGCTAAATTATGGTTTATACCGAAAAATGGAAATATATAGGCCTCATAAAGCCACTGCTGAAGAAATGACTAAATACCACAGCGATGAGTATATCAAGTTTCTACGATCAATAAGACCAGATAATATGTCTGAGTACAGTAAGCAGATGCAGAGATTTAACGTCGGAGAAGATTGTCCGGTGTTTGATGGACTCTTTGAGTTTTGTCAGCTCTCCACGGGTGGTTCAGTTGCTGGGGCTGTGAAATTAAACCGGCAACAAACTGATATGGCTGTCAATTGGGCTGGAGGACTACATCATGCCAAGAAGTCAGAAGCATCAGGGTTCTGCTATGTTAATGATATTGTGCTTGCCATCCTCGAATTACTTAAGTATCATCAGAGAGTCTTATATATTGACATAGACATCCACCATGGTGATGGTGTTGAGGAAGCTTTTTATACAACAGATCGCGTGATGAC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Olga S Safronova et al.
Nucleic acids research, 42(14), 8954-8969 (2014-07-25)
Hypoxia is associated with a variety of physiological and pathological conditions and elicits specific transcriptional responses. The elongation competence of RNA Polymerase II is regulated by the positive transcription elongation factor b (P-TEFb)-dependent phosphorylation of Ser2 residues on its C-terminal
Chun-Xia Luo et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 34(40), 13535-13548 (2014-10-03)
Stroke is a major public health concern. The lack of effective therapies heightens the need for new therapeutic targets. Mammalian brain has the ability to rewire itself to restore lost functionalities. Promoting regenerative repair, including neurogenesis and dendritic remodeling, may

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service