HMI0434

Sigma-Aldrich

MISSION® microRNA Mimic

hsa-miR-29a

Synonym(s):
hsa-miR-29a-3p
NACRES:
NA.51
Pricing and availability is not currently available.

Quality Level

product line

MISSION®

mature sequence

UAGCACCAUCUGAAAUCGGUUA

Sanger mature/minor accession no.

Sanger microRNA accession no.

storage temp.

−20°C

Gene Information

General description

The ready-to-use MISSION miRNA mimics are small, double-stranded RNA molecules designed to mimic endogenous mature miRNA molecules when introduced into cells. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. MISSION miRNA Mimics, a member of MISSION RNAi product family, provides miRNA researchers with a range of options from individual MISSION mimics to a full library of human miRNA mimics based on latest version of miRBase (currently hosted by the University of Manchester, previously hosted by the Sanger Institute).

  • Optimized and ready for transfection.
  • Novel MISSION miRNA mimic design has been functionally tested for knockdown efficiency against natural miRNA targets.
  • Unique MISSION miRNA mimic design significantly reduces possible sense strand off target effects.
  • Available as a whole human library and individual miRNA targets.

Other Notes

miRBase V18 Mature ID update: hsa-miR-29a-3p

Legal Information

MISSION is a registered trademark of Sigma-Aldrich Co. LLC

RIDADR

NONH for all modes of transport

WGK Germany

WGK 3

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Mengxing Ouyang et al.
Scientific reports, 7, 44757-44757 (2017-03-21)
Successful developments of new therapeutic strategies often rely on the ability to deliver exogenous molecules into cytosol. We have developed a versatile on-chip vortex-assisted electroporation system, engineered to conduct sequential intracellular delivery of multiple molecules into various cell types at...
Minfei Jin et al.
Stem cell research & therapy, 7(1), 167-167 (2016-11-20)
Pelvic floor dysfunction (PFD) is a condition affecting many women worldwide, with symptoms including stress urinary incontinence (SUI) and pelvic organ prolapse (POP). We have previously demonstrated stable elastin-expressing bone marrow-derived mesenchymal stem cells (BMSCs) attenuated PFD in rats, and...

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

MilliporeSigma

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.