HUTR09071

Sigma-Aldrich

MISSION® 3′UTR Lenti GoClone

Powered by SwitchGear Genomics, 3′UTR, human, CSNK2A1

Synonym(s):
HUTR
NACRES:
NA.51
Pricing and availability is not currently available.

description

Functional Validation of miRNA Gene Targets

product line

MISSION®

concentration

≥1x105 VP/ml (via p24 assay)

human 3′UTR sequence

CTTCACCCCTTGGACCTCTGGCAGGCTCACCAGTGATTGCTGCTGCCAACCCCCTTGGGATGCCTGTTCCAGCTGCCGCTGGCGCTCAGCAGTAACGGCCCTATCTGTCTCCTGATGCCTGAGCAGAGGTGGGGGAGTCCACCCTCTCCTTGATGCAGCTTGCGCCTGGCGGGGAGGGGTGAAACACTTCAGAAGCACCGTGTCTGAACCGTTGCTTGTGGATTTATAGTAGTTCAGTCATAAAAAAAAAATTAT (3′UTR sequences are truncated after the first 255 bases)

NCBI accession no.

shipped in

dry ice

storage temp.

−70°C

Gene Information

human ... CSNK2A1(1457)

Application

To see more application data, protocols, and vector maps visit www.sigma.com/3utr.

Physical form

200 μL of at least 105 VP/mL (via p24 titering assay) lentiviral particles are provided as frozen stock.

Legal Information

Use of this product is subject to one or more license agreements. For details, please see www.sigmaaldrich.com/missionlicense.
GoClone is a trademark of SwitchGear Genomics
MISSION is a registered trademark of Sigma-Aldrich Co. LLC
SwitchGear Genomics is a trademark of SwitchGear Genomics

RIDADR

UN 3245 9

WGK Germany

WGK 3

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificate of Analysis
Certificate of Origin

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

MilliporeSigma

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.