-70K, MHSTCMAG-70KPMX, and MHSTCMAG-70KPXBK
Control Catalog # MHSTC-6070, Lot # HSTC-106 and HSTC-206
MHSTC-6070: HSTC-106.206 (10 May 2021)
EMD MILLIPORE • 1-800-645-5476 • 1-800-645-5439 (FAX
course of activation (e.g. 349 ± 130 ms at -110
mV and 104 ± 32 ms at -140 mV, n=6). Under whole-cell recording conditions
the mean current amplitude was 2.7 ± 0.5 nA at -130 mV (n =10) and reversal
Clone:PKB-175 P2482 Signal Transduction M y y y
205 PKB/AKT P1601 Signal Transduction P y y y
206 PKB phosphoserine 473 (pS
473) P4112 Signal Transduction P n/d y y
207 PKB phosphothreonine 308
ccaccccccggacttgcatgggtagccgct),
were used. The binding sites for these two pairs of ZFNs are
separated by 206 base pairs on the genomic DNA (see figure 1).
ZFN activity by both of these ZFN pairs on the wild
Normal margin to UC SCC362
ht-230-D 59 F Duodenum Normal margin to UC SCC363
ht-206-CR 24 F Colon Crohns SCC365
ht-206-I-CR 24 F Ileum Crohns SCC366
ht-208-CR-CR 23 M Colon (Rectum) Crohns SCC367
ht
post
isolation; mean 99.3% ranging from 99 to 99.7%), both fromMiltenyi Biotec GmbH (cat no
130-091-104 and 130-096-535, respectively). T cells were activated with 1μg OKT-3/mL
(Biolegend, cat no 317315)
Configuration”
Figura 37: scelta dell’indirizzo per i file di backup
130 — Menu Utilities ed altre funzioni
Capitolo 6
Individuazione e risoluzione dei problemi
Installazione/avvio/disinstallazione
Configuration”
Figura 37: scelta dell’indirizzo per i file di backup
130 — Menu Utilities ed altre funzioni
Capitolo 6
Individuazione e risoluzione dei problemi
Installazione/avvio/disinstallazione