MilliporeSigma
Search Within
Document Type

206-130-6

Applied Filters:
Keyword:'206-130-6'
Showing 1-30 of 59 results for "206-130-6" within Technical Documents
Quality Control Ranges: MILLIPLEX® MAP Mouse High Sensitivity T Cell Magnetic Bead Panel
-70K, MHSTCMAG-70KPMX, and MHSTCMAG-70KPXBK Control Catalog # MHSTC-6070, Lot # HSTC-106 and HSTC-206 MHSTC-6070: HSTC-106.206 (10 May 2021) EMD MILLIPORE • 1-800-645-5476 • 1-800-645-5439 (FAX
Data Sheet - SAB4200512
E., et al., PloS One, 7, e39774 (2012). 3. Duleh, S.N., and Welch, M.D., Cytoskeleton, 67, 193-206 (2010). 4. Derivery, E., et al., Dev. Cell, 17, 712-723 (2009). ST,KCP,PHC 11/12-1
Product Information - L6412
ligands included: A1260 Amantadine hydrochloride A-206 Agroclavine A-255 A-77636 hydrochloride B-102 Bupropion hydrochloride B-135 R(+)-6-Bromo-APB hydrobromide B-168 (±)-Butaclamol hydrochloride
Data Sheet - L6412
ligands included: A1260 Amantadine hydrochloride A-206 Agroclavine A-255 A-77636 hydrochloride B-102 Bupropion hydrochloride B-135 R(+)-6-Bromo-APB hydrobromide B-168 (±)-Butaclamol hydrochloride
Poster - Binding using SPR Biacore
100 1e-6 2e-6 3e-6 4e-6 6e-6 7e-65e-6 8e-6 M 80 40 0 KD=3.8 µM Concentration R e sp o n se 0 20 RU 60 120 100 1e-6
Quality Control Ranges: MILLIPLEX® MAP Human Cytokine/ Chemokine Magnetic Bead Panel
mL Control 2 490 – 1017 pg/mL Control 2 408 – 847 pg/mL MCP-1 Control 1 99 – 206 pg/mL
Data Sheet - C9869 - Lot 118K0528
al., Impaired spatial learning in alpha- calcium calmodulin kinase II mutant mice. Science, 257, 206-211 (1992). 2. Thiagarajan, T.C. et al., Alpha- and beta-CaMKII: inverse regulation by neuronal
Data Sheet - C9869
al., Impaired spatial learning in alpha- calcium calmodulin kinase II mutant mice. Science, 257, 206-211 (1992). 2. Thiagarajan, T.C. et al., Alpha- and beta-CaMKII: inverse regulation by neuronal
XP725 Antibody Number-Lot Number 071M4826
247 248 269 270 271 272 3.3 201 202 203 204 225 226 227 228 249 250 251 252 273 274 275 276 3.4 205 206 207 208 229 230 231 232 253 254 255 256 277 278 279 280 3.5 209 210
MILLIPLEX®MAP Human Myokine Panel is an optimized quantitative immunoassay that simultaneously measures 15 novel muscle-secreted factors
52 34 50 42 134 125 43 145 40 85 56 85 45 207 5751 std 6 180 97 200 138 278 392 75 286 154 276 184 306 64 352 8683 193 92 206 147 283
Product Information Sheet - I6125
Methods Enzymol., 17B, 677, 1971. 29. Stadtman, T.C. and Grant, M.A., Methods Enzymol., 17B, 206, 1971. 30. Foster, M. and Harrison, J.H., Biochim. Biophys. Acta, 351, 295, 1974. 31. Kitamura
Product Information Sheet - I1149
Methods Enzymol., 17B, 677, 1971. 29. Stadtman, T.C. and Grant, M.A., Methods Enzymol., 17B, 206, 1971. 30. Foster, M. and Harrison, J.H., Biochim. Biophys. Acta, 351, 295, 1974. 31. Kitamura
Product Information Sheet - 11206893001
Inhibitor Working concentration(1) Antipain-dihydrochloride 50 μg/ml (74 μM) Bestatin 40 μg/ml (130 μM) Chymostatin 6 – 60 μg/ml (10 – 100 μM) E-64 0.5 – 10 μg/ml (1.4 – 28 μM) Leupeptin 0.5 – 5 μg/ml (1 – 10
hHCN1-HEK293 Recombinant Cell Line
course of activation (e.g. 349 ± 130 ms at -110 mV and 104 ± 32 ms at -140 mV, n=6). Under whole-cell recording conditions the mean current amplitude was 2.7 ± 0.5 nA at -130 mV (n =10) and reversal
hHCN2-HEK293 Recombinant Cell Line
-140 -130 -120 -110 -100 -90 -80 -70 -60 -50 -1.4 -1.2 -1.0 -0.8 -0.6 -0.4 -0.2 0.0 Voltage (mV) Normalized Current B
Outstanding performance Purospher®STAR HPLC and UHPLC columns - EMD
7.5-8.2 min, background subtracted -MS, 8.5-9.3 min, background subtractedIbuprofen M=206 Fenoprofen M=206 M-H-CO2 209.0 197.1 241.0 482.9 161.2 205.1 411.0433.2 505.0 M-H
Product Information - CSAA1
Clone:PKB-175 P2482 Signal Transduction M y y y 205 PKB/AKT P1601 Signal Transduction P y y y 206 PKB phosphoserine 473 (pS 473) P4112 Signal Transduction P n/d y y 207 PKB phosphothreonine 308
PKH Dye Reference Guide
lifetime 94, 150, 200, 207, 208 Proliferation, growth control 29, 126, 130 Differentiation, embryogenesis 4, 9, 29, 87, 126, 130, 148 Adhesion 69, 46, 196 Blood flow assessment 68
Brochure: Purospher STAR HPLC and UHPLC Columns
7.5-8.2 min, background subtracted -MS, 8.5-9.3 min, background subtractedIbuprofen M=206 Fenoprofen M=206 209.0 197.1 241.0 482.9 161.2 205.1 411.0433.2 505.0 M-H 253.0 2M-H506.9
Product Information Sheet - CHODHFR
ccaccccccggacttgcatgggtagccgct), were used. The binding sites for these two pairs of ZFNs are separated by 206 base pairs on the genomic DNA (see figure 1). ZFN activity by both of these ZFN pairs on the wild
User Guide - SCC310-370
Normal margin to UC SCC362 ht-230-D 59 F Duodenum Normal margin to UC SCC363 ht-206-CR 24 F Colon Crohns SCC365 ht-206-I-CR 24 F Ileum Crohns SCC366 ht-208-CR-CR 23 M Colon (Rectum) Crohns SCC367 ht
Mouse Metabolic Hormone Expanded Panel
37 130 222 278 296 Standard 5 111 389 667 833 889 Standard 6 333 1,167 2,000 2,500 2,667 Standard 7 1,000 3,500 6,000 7,500 8,000 Standard
Protocol- MMHE-44K
4 37 130 222 278 296 Standard 5 111 389 667 833 889 Standard 6 333 1,167 2,000 2,500 2,667 Standard 7 1,000 3,500 6,000 7,500 8,000 Standard
Cytoskeletal Signaling Antibodies, Reagents and Kits
Integrin Molecular Weights (kDa) by SDS-PAGE MW (kDa) Reduced Conditions 210 165 130 150 135 120 125 120 130 95 105 220 110 MW (kDa) Non-Reduced Conditions 200 160 150 140 155 140 150 145 110
Evaluation of Intracellular Signaling - Downstream Chimeric Antigen Receptors
post isolation; mean 99.3% ranging from 99 to 99.7%), both fromMiltenyi Biotec GmbH (cat no 130-091-104 and 130-096-535, respectively). T cells were activated with 1μg OKT-3/mL (Biolegend, cat no 317315)
Shaping Epigenetics Discovery - Epigenetics Product Selection Brochure
P68431*) H4 (P62805*) N 140 C P PP P 120 130 H2A.X (P16104*) K T S A T V G P K A P S G G K K A T Q A S Q E
Chrombook 2015 - The world of chromatography in your hands
Analytical HPLC 219 -20 30 80 130 180 230 0 4 8 12 [mAU] Retention time [min] 4.6 [min] 0 1
Steritest Equinox Pump PC Software V2.1 SP1 - User Guide
Configuration” Figura 37: scelta dell’indirizzo per i file di backup 130 — Menu Utilities ed altre funzioni Capitolo 6 Individuazione e risoluzione dei problemi Installazione/avvio/disinstallazione
Brochure: The Supelco® HPLC and UHPLC Column Selection Guide
silica 2 130 1 300 6 2 - 7.5 50 No Diol L20 Diolsilane Monolithic Type B silica 2 130 1 300 9 2 - 7.5 50 No NH2 L8 Aminopropyl- silane Monolithic Type B silica
User Guide Equinox SOP Software 2.1 for Windows XP
Configuration” Figura 37: scelta dell’indirizzo per i file di backup 130 — Menu Utilities ed altre funzioni Capitolo 6 Individuazione e risoluzione dei problemi Installazione/avvio/disinstallazione
Page 1 of 2
Page 1 of 2