Skip to Content
MilliporeSigma
Search Within
Document Type

213-207-8

Applied Filters:
Keyword:'213-207-8'
Showing 1-30 of 57 results for "213-207-8" within Technical Documents
Data Sheet - M1320
Monoclonal Anti-MTA1, clone MTA1-213 (M1320) - Data Sheet Monoclonal Anti-MTA1 antibody produced in mouse clone MTA1-213, purified from hybridoma cell culture Catalog Number M1320 Product
Product Information Sheet - M0880
, et al., Nature, 198, 447-8 (1963). 4. Merck Index, 11th ed., Entry# 3782. 5. Alderson, T., Chemically Induced Delayed Germinal Mutation in Drosophila. Nature, 207(993), 164-167 (1965).
TB394VM pCDF-2 Ek/LIC Vector Map
I (1752) Nco I (69) Ava I (134) Xho I (134) Pml I (94) Acc I (191) Pac I (209) Avr II (213) BspM I (901) GACTCCTGCATTAGGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTGTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA
TB408 pCOLADuet™-1 Vector Map
1922 AclI 1 3564 Afl II 1 163 Afl III 1 3224 AgeI 1 566 ApaI 1 3021 ApaLI 1 3244 AscI 1 125 AseI 6 213 732 921 2482 2541 3702 AsiSI 1 337 AvaI 2 354 1246 AvrII 1 433 BaeI 1 365 BamHI 1 106 BanI 4 348
Quality Control Ranges: MILLIPLEX® MAP Human Cytokine/ Chemokine Magnetic Bead Panel
pg/mL Control 2 498 – 1035 pg/mL IFN α 2 Control 1 91 – 189 pg/mL IL-8 Control 1 102 – 213 pg/mL
Data Sheet - E1528
(1998). 7. de Jager, T. et al., J. Biol. Chem., 276, 27873- 27880 (2001). 8. Yellayi, S. et al., Endocrine, 12, 207-213 (2000). 9. Suo,Z, et al. Virchows Arch., 439, 62-69 (2001). 10. Wyckoff, M.H.
Product Information Sheet - M7008
Description Molecular Formula: C15H16O7 Molecular Weight: 308.3 CAS Number: 6734-33-4 Melting Point: 213-214 °C1 Specific Rotation: -42° (0.1% (w/v) in water)1 Synonyms: 4-Methylumbelliferyl-β-D-xyloside
Product Information Sheet - 11442066001
ready-to-use tablets 20 tablets 11 697 471 001 NBT/BCIP Stock Solution 8 ml 11 681 451 001 NBT Solution 3 ml (300 mg) 11 383 213 001 NBT crystals 5 g 11 585 029 001 Labeling of Biomolecules
Product Information Sheet - P2277
1974). 7. Crouch, T. H. et al., Biochem., vol 19, 3692-3698 (1980). 8. Klee, C. and Vanaman, T., Adv. Protein Chem., 35, 213-321 (1982). 9. Means, A. et al., Physiol. Reviews, 62, 1-39 (1982) 10.
TB045VM pET-15b Vector Map
452 His•Tag coding sequence 362-380 Multiple cloning sites (Nde I - BamH I) 319-335 T7 terminator 213-259 lacI coding sequence (866-1945) pBR322 origin 3882 bla coding sequence 4643-5500 pET-15b cloning
XP725 Antibody Number-Lot Number 071M4826
251 252 273 274 275 276 3.4 205 206 207 208 229 230 231 232 253 254 255 256 277 278 279 280 3.5 209 210 211 212 233 234 235 236 257 258 259 260 281 282 283 284 3.6 213 214
TB390VM pCDFDuet™-1 Vector Map
AclI 1 3626 AflII 1 163 AflIII 2 1666 3286 AgeI 1 566 ApaI 1 3083 ApaLI 2 1193 3306 AscI 1 125 AseI 4 213 2544 2603 3764 AsiSI 1 337 AvaI 1 354 AvrII 1 433 BaeI 2 365 1972 BamHI 1 106 BanI 4 348 2517 2647
TB049VM pET-19b Vector Map
start 471 His•Tag coding sequence 366-395 Multiple cloning sites (Nde I -BamH I) 319-335 T7 terminator 213-259 lacI coding sequence 875-1954 pBR322 origin 3891 bla coding sequence 4652-5509 The pET-19b vector
TB046VM pET-16b Vector Map
start 465 His•Tag coding sequence 360-389 Multiple cloning sites (Nde I -BamH I) 319-335 T7 terminator 213-259 lacI coding sequence 869-1948 pBR322 origin 3885 bla coding sequence 4646-5503 The pET-16b vector
TB397VM pET-46 Ek/LIC Vector Map
(4958) pET-46 Ek/LIC 5200 bp Hinc II (1578) Ava I (176) Xho I (176) Pml I (220)Avr II (213) Nco I (241) GATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA
TB042VM pET-11a-d Vector Map
landmarks T7 promoter 432-448 T7 transcription start 431 T7•Tag coding sequence 328-360 T7 terminator 213-259 lacI coding sequence 835-1914 pBR322 origin 3851 bla coding sequence 4612-5469 The maps for
Product Information Sheet - PR0100
At4g26070 226 G1 At2g13790 225 G2 At2g32210 169 G3 At4g11370 213 G4 At4g34390 189 G5 At5g47910 207 G6
Product Information - CSAA1
Clone:PK-G4 P8083 Signal Transduction M n/d n/d y 212 PKD P3987 Signal Transduction P y y n/d 213 Map Kinase Phosphatase-1 (MKP-1) M3787 Signal Transduction P y n/d n/d 214 Protein phosphatase 1α
XP725 Antibody List Lot 129K4831
P2482 207 AKT1 M NP_001014431.1,NP_001014432.1 , NP_005154.2, y y y 575 Protein Kinase Ba /Akt1 P1601 207 AKT1 P NP_001014431.1,NP_001014432.1 , NP_005154.2, y y y 577 phospho-PKB (pSer473) P4112 207 AKT1
XP725 Antibody List Lot 129K4830
P2482 207 AKT1 M NP_001014431.1,NP_001014432.1 , NP_005154.2, y y y 575 Protein Kinase Ba /Akt1 P1601 207 AKT1 P NP_001014431.1,NP_001014432.1 , NP_005154.2, y y y 577 phospho-PKB (pSer473) P4112 207 AKT1
XP725 Antibody List Lot 089K4791
P2482 207 AKT1 M NP_001014431.1,NP_001014432.1 , NP_005154.2, y y y 575 Protein Kinase Ba /Akt1 P1601 207 AKT1 P NP_001014431.1,NP_001014432.1 , NP_005154.2, y y y 577 phospho-PKB (pSer473) P4112 207 AKT1
Chrombook 2015 - The world of chromatography in your hands
68, 108, 188, 192, 194, 196, 199, 201, 202, 207, 230, 244, 262, 283, 308, 309, 312, 325, 329, 342, 408, 410 C9 – C18 457 Cost savings 213 Customized HPLC column
Inhibitor Sourcebook 3rd Edition
407721 ...........................................................207 407850 .......................................................... 213 407900 .........................................................
Research Article: MCP-1, KC-like and IL-8 as critical mediators of
canine babesiosis is associated with a consumptive coagulopathy. Veterinary Journal. 2013; 196(2):213–7. 48. Mackness B, Hine D, Liu YF, Mastorikou M, Mackness M. Paraoxonase-1 inhibits oxidised LDL-induced
Product Information Sheet - HPFM2
immobilisation of biomolecules in a microarray (2004), Combinatorial Chemistry & High Throughput Screening, 7, 213-221, Yeo DSY, Panicker RC, Tan L-P and Yea SQ 4. Enzymatic activity on a chip: The critical role
Product Information Sheet - HPFM3
immobilisation of biomolecules in a microarray (2004), Combinatorial Chemistry & High Throughput Screening, 7, 213-221, Yeo DSY, Panicker RC, Tan L-P and Yea SQ. 4. Enzymatic activity on a chip: The critical role
XP725 Antibody List
001101103.1 M y y y 574 Protein Kinase Bα /Akt1 P2482 207, 11651, 24185 AKT1,Akt1 NP_005154.2,NP_033782.1,NP_150233.1 M y y y 575 Protein Kinase Bα /Akt1 P1601 207, 11651, 24185 AKT1,Akt1 NP_005154.2,NP_033782.1
XP725 Antibody List 013M4793
001101103.1 M y y y 574 Protein Kinase Bα /Akt1 P2482 207, 11651, 24185 AKT1,Akt1 NP_005154.2,NP_033782.1,NP_150233.1 M y y y 575 Protein Kinase Bα /Akt1 P1601 207, 11651, 24185 AKT1,Akt1 NP_005154.2,NP_033782.1
Panorama Human Protein Functional Array-Signal Transduction
immobilisation of biomolecules in a microarray (2004), Combinatorial Chemistry & High Throughput Screening, 7, 213-221, Yeo DSY, Panicker RC, Tan L-P and Yea SQ. 4. Enzymatic activity on a chip: The critical role
User Guide - Milli-Q® HX and HR 7000 Series
Milli-Q® HR 7060 72 / 159 91 / 200 222/489 Milli-Q® HR 7120 75 / 165 94 / 207 225/496 Milli-Q® HR 7170 78 / 172 97 / 213 228/502 Milli-Q® HR 7220 84 / 185 103
Page 1 of 2