Document Type
Showing 1-22 of 22 results for "215-721-8"
XP725 Antibody Number-Lot Number 071M4826
597 598 599 600 621 622 623 624 645 646 647 648 669 670 671 672 8.1 673 674 675 676 697 698 699 700 721 722 723 724 745 746 747 748 8.2 677 678 679 680 701 702 703 704...
Product Information Sheet - T4376
al., Agents Actions, 36, 243 (1992). 33. Griscavage, J.M. et al., Biochem. Biophys. Res. Commun., 215, 721, (1995). 34. Chou, I.-N. et al., Proc. Natl Acad. Sci., USA 71, 1748 (1974). 35. Richman, N. and
Product Information Sheet - T7254
, Agents Actions, 36, 243, (1992). 31. Griscavage, J.M. et al., Biochem. Biophys. Res. Commun., 215, 721, (1995). 32. Fearnhead, H.O. et al. Toxicol. Lett., 82/83, 135, (1995). 33. Grammer, T.C. and
Product Information Sheet - MTOX1000P96
7520 6732 7477 7416 7710 7541 7308 Day 14 ohms*cm2 (Calculated Data) 766 781 786 777 762 800 708 721 769 770 782 825 693 801 797 813 816 827 741 822 816 848 830 804 Day 21 ohms (Raw Data) 6844 6699
Product Information Sheet - APPA010
****** 720 KpnI BamHI GFP S11 cont.’d STOP (TAA) 721 ************************************TAAAGCGGCCGCGACTCTAGATCATAATCAGCCATACCACATTT 800 721 ************************************ATTTCGCCGGCGCTGAGATCTAGTATTAGTCGGTATGGTGTAAA
Product Information Sheet - APPA005
****** 720 KpnI BamHI GFP S11 cont.’d STOP (TAA) 721 ************************************TAAAGCGGCCGCGACTCTAGATCATAATCAGCCATACCACATTT 800 721 ************************************ATTTCGCCGGCGCTGAGATCTAGTATTAGTCGGTATGGTGTAAA
Product Information Sheet - APPA011
****** 720 KpnI BamHI GFP S11 cont.’d STOP (TAA) 721 ************************************TAAAGCGGCCGCGACTCTAGATCATAATCAGCCATACCACATTT 800 721 ************************************ATTTCGCCGGCGCTGAGATCTAGTATTAGTCGGTATGGTGTAAA
Product Information Sheet - MTOX1006P96
7520 6732 7477 7416 7710 7541 7308 Day 14 ohms*cm2 (Calculated Data) 766 781 786 777 762 800 708 721 769 770 782 825 693 801 797 813 816 827 741 822 816 848 830 804 Day 21 ohms (Raw Data) 6844 6699
Product Information Sheet - MTOX1005P96
7520 6732 7477 7416 7710 7541 7308 Day 14 ohms*cm2 (Calculated Data) 766 781 786 777 762 800 708 721 769 770 782 825 693 801 797 813 816 827 741 822 816 848 830 804 Day 21 ohms (Raw Data) 6844 6699
Product Information Sheet - MTOX1002P96
7520 6732 7477 7416 7710 7541 7308 Day 14 ohms*cm2 (Calculated Data) 766 781 786 777 762 800 708 721 769 770 782 825 693 801 797 813 816 827 741 822 816 848 830 804 Day 21 ohms (Raw Data) 6844 6699
Product Information Sheet - MTOX1004P96
7520 6732 7477 7416 7710 7541 7308 Day 14 ohms*cm2 (Calculated Data) 766 781 786 777 762 800 708 721 769 770 782 825 693 801 797 813 816 827 741 822 816 848 830 804 Day 21 ohms (Raw Data) 6844 6699
Product Information Sheet - MTOX1003P96
7520 6732 7477 7416 7710 7541 7308 Day 14 ohms*cm2 (Calculated Data) 766 781 786 777 762 800 708 721 769 770 782 825 693 801 797 813 816 827 741 822 816 848 830 804 Day 21 ohms (Raw Data) 6844 6699
Product Information Sheet - MTOX1001P96
7520 6732 7477 7416 7710 7541 7308 Day 14 ohms*cm2 (Calculated Data) 766 781 786 777 762 800 708 721 769 770 782 825 693 801 797 813 816 827 741 822 816 848 830 804 Day 21 ohms (Raw Data) 6844 6699
Product Information Sheet - 3353621001
DNA Molecular Weight Marker XIII 50 �g (1 A260 unit) 11 721 925 001 DNA Molecular Weight Marker XIV 50 �g (1 A260 unit) 11 721 933 001 5‘/3‘ RACE Kit, 2nd Generation y Version 14
XP725 Antibody List Lot 089K4791
gamma A3108 7022 TFAP2C M NP_003213.1 y n/d n/d 230 DP2 D7438 7029 TFDP2 M NP_001171609.1 y n/d n/d 721 Transforming Growth Factor-?, pan T9429 7040 TGFB1 P NP_000651.3 y n/d n/d 746 Tyrosin hydroxylase
XP725 Antibody List Lot 129K4830
gamma A3108 7022 TFAP2C M NP_003213.1 y n/d n/d 230 DP2 D7438 7029 TFDP2 M NP_001171609.1 y n/d n/d 721 Transforming Growth Factor-?, pan T9429 7040 TGFB1 P NP_000651.3 y n/d n/d 746 Tyrosin hydroxylase
XP725 Antibody List Lot 129K4831
gamma A3108 7022 TFAP2C M NP_003213.1 y n/d n/d 230 DP2 D7438 7029 TFDP2 M NP_001171609.1 y n/d n/d 721 Transforming Growth Factor-?, pan T9429 7040 TGFB1 P NP_000651.3 y n/d n/d 746 Tyrosin hydroxylase
XP725 Worksheet for Lot Number 071M4826
H3 pSer10 H0412 718 4 3 6 6 Histone H3 pSer10 H0412 719 4 3 6 7 Anti CY3/5 C0992 720 4 3 6 8 Anti CY3/5 C0992 721 4 4 1 1 SUV39H1 Histone Methyl Transferase S8316 722 4 4 1 2 SUV39H1 Histone...
List of Antibodies
n/d n/d 718 TRAIL T3067 M y n/d n/d 719 TRAIL T9191 P y n/d n/d 720 Anti Cy3+Cy5 C0992 M NA NA NA 721 Transforming Growth Factor-β, pan T9429 P y n/d n/d 722 Transportin 1 T0825 M y y y 723 TRF1
XP725 Antibody List
TNFSF10 NP_003801.1 M y n/d n/d 719 TRAIL T9191 8743 TNFSF10 NP_003801.1 P y n/d n/d 720 Anti Cy3+Cy5 721 Transforming Growth Factor-β, pan T9429 7040, 7042, 7043 TGFB3,TGFB1,TGFB2 NP_000651.3,NP_003229.1
XP725 Antibody List 013M4793
NP_003801.1 M y n/d n/d 719 TRAIL T9191 8743 TNFSF10 NP_003801.1 P y n/d n/d 720 Anti Cy3+Cy5 C0992 721 Transforming Growth Factor-β, pan T9429 7040, 7042, 7043 TGFB3,TGFB1,TGFB2 NP_000651.3,NP_003229.1

Social Media

LinkedIn icon
Twitter icon
Facebook Icon
Instagram Icon

MilliporeSigma

Research. Development. Production.

We are a leading supplier to the global Life Science industry with solutions and services for research, biotechnology development and production, and pharmaceutical drug therapy development and production.

© 2021 Merck KGaA, Darmstadt, Germany and/or its affiliates. All Rights Reserved.

Reproduction of any materials from the site is strictly forbidden without permission.