Document Type
Showing 1-30 of 166 results for "

55-63-0

"
The Effective Use of Protein Kinase Inhibitors
100 21 63 26 S6K1 0 94 32 98 93 92 86 100 87 75 106 81 25 109 95 101 6 32 18 GSK-3β 107 92 90 13 38 105 83 101 66 61 85 53 30...
The Effective Use of Protein Kinase Inhibitors
100 21 63 26 S6K1 0 94 32 98 93 92 86 100 87 75 106 81 25 109 95 101 6 32 18 GSK-3β 107 92 90 13 38 105 83 101 66 61 85 53 30...
White Paper: A Cost Analysis and Evaluation of Perfused Seed Train Scenarios Through Process Modeling
315.63 Batches/yr 99 63 55 63 Bottleneck unit operation N-1 Perfused Rocker N-1 N-2 Rocker Bottleneck time (days/batch) 2.64 4.12 4.76 4.12 Batches/yr 99 63 55 63 3:1 production/seed
Product Information Sheet - P3644
precipitation procedures. The major phospholipids as assayed by TLC are typically an average of 55%(42-63%) phosphatidylcholine and 20%(10-32%) phosphatidylethanolamine. Other trace components such
Data Sheet - B4062
mM NaCl, 0.25 mM DTT, 0.1 mM EGTA, 0.1 mM EDTA, 0.1 mM PMSF, and 25% glycerol. Molecular mass: ∼63 kDa Precautions and Disclaimer This product is for R&D use only, not for drug, household, or other
BRAF (416-766) Active (B4062)
0.1 mM EDTA, 0.1 mM PMSF, and 25% glycerol. Molecular mass: ∼63 kDa Purity: ≥70% (SDS-PAGE, see Figure 1) Specific Activity: 63–85 nmole/min/mg (see Figure 2) Precautions and Disclaimer This
BRAF (416-766) Active (B4062)
0.1 mM EDTA, 0.1 mM PMSF, and 25% glycerol. Molecular mass: ∼63 kDa Purity: ≥70% (SDS-PAGE, see Figure 1) Specific Activity: 63–85 nmole/min/mg (see Figure 2) Precautions and Disclaimer This
Data Sheet - B4062
0.1 mM EDTA, 0.1 mM PMSF, and 25% glycerol. Molecular mass: ∼63 kDa Purity: ≥70% (SDS-PAGE, see Figure 1) Specific Activity: 63–85 nmole/min/mg (see Figure 2) Precautions and Disclaimer This
Data Sheet - B4062
0.1 mM EDTA, 0.1 mM PMSF, and 25% glycerol. Molecular mass: ∼63 kDa Purity: ≥70% (SDS-PAGE, see Figure 1) Specific Activity: 63–85 nmole/min/mg (see Figure 2) Precautions and Disclaimer This
Data Sheet - K3268
glycerol. Molecular mass: ∼130 kDa Purity: ≥70% (SDS-PAGE, see Figure 1) Specific Activity: 47–63 nmole/min/mg (see Figure 2) Precautions and Disclaimer This product is for R&D use only, not for
Data Sheet - C9494
72 100 130 170 55 33 Figure 2. Specific Activity of Lot Number 019K1565: 223 nmole/min/mg 0 100,000 200,000 300,000 400,000 500,000 0 40 80 120 160...
Fast GC-A Practical Guide for Increasing Sample Throughput without Sacrificing Quality
35 36 37 38 39 40 41 42 43 44 45 46 52 53 54 55 56 5758 59 60 61 62 63 64 65 ...
Product Information Sheet - E0504
carinatus venom Product Number E 0504 Storage Temperature -0 °C Product Description CAS Number: 55466-26-7 Molecular weight: 55 kDa (gel filtration in the presence of 6 M guanidine)1 pI: 4.4
Product Information Sheet - M2128
growth and survival: application to proliferation and cytotoxicity assays. J. Immunol. Methods., 65, 55-63 (1983). 5. Rastinejad, F., et al., Tumor suppression by RNA from the 3' untranslated region
Data Sheet - C9619
components of a Ca2+/calmodulin-dependent protein kinase cascade in HeLa cells. FEBS Lett., 550, 57-63 (2003). PRECISIO is a registered trademark of Sigma-Aldrich Co. LLC. JB,TLD,MAM 07/14-1 
Data Sheet - N9913
mM NaCl, 0.25 mM DTT, 0.1 mM EGTA, 0.1 mM EDTA, 0.1 mM PMSF, and 25% glycerol. Molecular mass: ∼63 kDa Purity: ≥70% (SDS-PAGE, see Figure 1) Specific Activity: 188–254 nmole/min/mg (see Figure
Data Sheet - K2643
34 43 72 95 130 170 56 Figure 2. Specific Activity of Lot Number 118K0514: 63 nmole/min/mg Procedure Preparation Instructions Kinase Assay Buffer – 25 mM MOPS, pH 7.2, 12.5
Data Sheet - M9322
Waskiewicz, A.J. et al., EMBO J., 16(8), 1909-20 (1997). 2. Slentz-Kesler, K. et al., Genomics, 69(1), 63-71 (2000). JR,MAM 07/09-1 Sigma brand products are sold through Sigma-Aldrich, Inc. Sigma-Aldrich
Application Note - Universal ProbeLibrary for Quantitative Expression Analysis in Zebrafish
SYBR Green I Forward/reverse primer (UPL) Forward/reverse primer her5 GGAGCAAAAAGACATGAGAAGG/ 63 TGAAAACATACACAAATCGCACTC/ TCTCAAGGTTTCTAGGCTTTGATT CCTCATAGAGATGCACCTGAGTTT pax2a GGCAGCTACCCACCTCTA
FcFusionProteinSeparation
10 15 20 25 mAU 0 10 20 30 40 50 8. 67 8 10 .6 08 12 .4 63 13 .9 74 15 .4 40 19 .8 95 ...
One-Step Purification of Histidine-Tagged Fusion Proteins Under High Pressure and High Flow Conditions
YIAWPLQGWQATFGGGDHPPK 2357.688 44–63 KFELGLEFPNLPYYIDGDVK 2942.367 40–63 WRNKKFELGLEFPNLPYYIDGDVK 3156.455 18–41 LLLEYLEEKYEEHLYERDEGDKWR 3486.885 35–63 DEGDKWRNKKFE…PNLPYYIDGDVK 3486.885 35–63 DEGDKWRNKKFE…PNLPYYIDGDVK
Data Sheet - M9322
Waskiewicz, A.J. et al., EMBO J., 16(8), 1909-20 (1997). 2. Slentz-Kesler, K. et al., Genomics, 69(1), 63-71 (2000). JR,MAM 02/09-1 Sigma brand products are sold through Sigma-Aldrich, Inc. Sigma-Aldrich
Data Sheet - N9788
mM NaCl, 0.25 mM DTT, 0.1 mM EGTA, 0.1 mM EDTA, 0.1 mM PMSF, and 25% glycerol. Molecular mass: ∼63 kDa Precautions and Disclaimer This product is for R&D use only, not for drug, household, or other
Data Sheet - M9322
Waskiewicz, A.J. et al., EMBO J., 16(8), 1909-20 (1997). 2. Slentz-Kesler, K. et al., Genomics, 69(1), 63-71 (2000). PRECISIO is a registered trademark of Sigma-Aldrich Co. LLC. AD,TD,MAM 10/
Data Sheet - C9619
components of a Ca2+/calmodulin-dependent protein kinase cascade in HeLa cells. FEBS Lett., 550, 57-63 (2003). TLD, MAM 02/09-1 Sigma brand products are sold through Sigma-Aldrich, Inc. Sigma-Aldrich
Data Sheet - N9788
mM NaCl, 0.25 mM DTT, 0.1 mM EGTA, 0.1 mM EDTA, 0.1 mM PMSF, and 25% glycerol. Molecular mass: ∼63 kDa Purity: ≥70% (SDS-PAGE, see Figure 1) Specific Activity: 114–154 nmole/min/mg (see Figure
Data Sheet - 05420
Amino Acid: Asp Asn Thr Ser Glu Gln Pro Gly Ala Cys Val Met Ile Residues: 39 15 30 22 60 23 25 12 63 35 39 6 8 Amino Acid: Leu Tyr...
Data Sheet - M9822
mM NaCl, 0.25 mM DTT, 0.1 mM EGTA, 0.1 mM EDTA, 0.1 mM PMSF, and 25% glycerol. Molecular mass: ∼63 kDa Purity: ≥70% (SDS-PAGE, see Figure 1) Specific Activity: 225–305 nmole/min/mg (see Figure
Data Sheet - M0198
mM NaCl, 0.25 mM DTT, 0.1 mM EGTA, 0.1 mM EDTA, 0.1 mM PMSF, and 25% glycerol. Molecular mass: ∼63 kDa Purity: ≥70% (SDS-PAGE, see Figure 1) Specific Activity: 6–8 nmole/min/mg (see Figure 2)
Data Sheet - N9788
mM NaCl, 0.25 mM DTT, 0.1 mM EGTA, 0.1 mM EDTA, 0.1 mM PMSF, and 25% glycerol. Molecular mass: ∼63 kDa Purity: ≥70% (SDS-PAGE, see Figure 1) Specific Activity: 114–154 nmole/min/mg (see Figure