MilliporeSigma
  • Home
  • Search Results
  • DNA Functionalized Direct Electro-deposited Gold nanoaggregates for Efficient Detection of Salmonella typhi.

DNA Functionalized Direct Electro-deposited Gold nanoaggregates for Efficient Detection of Salmonella typhi.

Bioelectrochemistry (Amsterdam, Netherlands) (2015-04-29)
Anu Singh, Meenakshi Choudhary, M P Singh, H N Verma, Surinder P Singh, Kavita Arora
ABSTRACT

Direct electro-deposition of gold nano-aggregates (GNAs) was carried out to fabricate electrochemical DNA biosensor for the detection of Salmonella typhi in urine and blood samples. Size of depositing GNAs was controlled by regulating electro-deposition parameters at physiological pH. This facilitated achieving biocompatible GNAs with desired electrochemical behaviour and enhanced surface area to achieve higher DNA loading. Salmonella typhi (S. typhi) specific 5'amine modified single stranded DNA (ssDNA, NH2-(C6)-5'CGTGCGCGACGCCCGCCGCC3') was covalently immobilized on to GNAs-ITO (indium tin oxide) electrode. Dynamic detection range of 4 aM - 24 fM. using methylene blue (MB) redox indicator at 25 °C was achieved using ssDNA-GNAs-ITO bio-electrode to detect the complimentary target sequence (5'GGCGGCGGGCGTCGCGCACG 3') through differential pulse voltammetry (DPV) and electrochemical impedance spectroscopy (EIS). Selectivity of designed electrode was ascertained by response signal for complementary, non-complementary and 1 base mismatch sequences. Furthermore, clear distinction in complementary and non-complimentary targets was obtained by EIS studies for genomic DNA in culture spiked biological fluids 'CSBF' (blood and urine). This study for detection of S. typhi from urine and blood samples using fabricated ssDNA-GNA-ITO bio-electrode showed promising results and have potential to be used as sensor for real patient samples.

MATERIALS
Product Number
Brand
Product Description

Sigma-Aldrich
Ethylenediaminetetraacetic acid, purified grade, ≥98.5%, powder
Sigma-Aldrich
Ethylenediaminetetraacetic acid, anhydrous, crystalline, BioReagent, suitable for cell culture
Sigma-Aldrich
Ethylenediaminetetraacetic acid, ACS reagent, 99.4-100.6%, powder
Sigma-Aldrich
Ethylenediaminetetraacetic acid, BioUltra, anhydrous, ≥99% (titration)
Sigma-Aldrich
Potassium, cubes (in mineral oil), 99.5% trace metals basis
Sigma-Aldrich
Potassium hydride, in paraffin
Sigma-Aldrich
N-Hydroxysuccinimide, 98%
Sigma-Aldrich
Potassium hydride, 30 wt % dispersion in mineral oil
Sigma-Aldrich
Ethylenediaminetetraacetic acid, 99.995% trace metals basis
Sigma-Aldrich
Methylene Blue solution, 0.05 wt. % in H2O
Sigma-Aldrich
1,2-Dichloroethane, anhydrous, 99.8%
Sigma-Aldrich
Potassium, chunks (in mineral oil), 98% trace metals basis
Supelco
Acetone solution, contains 20.0 % (v/v) acetonitrile, suitable for HPLC
Sigma-Aldrich
Trichloroacetic acid solution, 6.1 N
Sigma-Aldrich
Methylene blue, certified by the Biological Stain Commission
Sigma-Aldrich
Methylene Blue solution, 1.4 % (w/v) in 95% ethanol
Sigma-Aldrich
Ethylenediaminetetraacetic acid solution, 0.02% in DPBS (0.5 mM), sterile-filtered, BioReagent, suitable for cell culture
Sigma-Aldrich
Methylene Blue solution, for microscopy, concentrate according to Ehrlich, concentrated, aqueous solution
Sigma-Aldrich
Trichloroacetic acid, ≥99.0% (titration)
Sigma-Aldrich
Trichloroacetic acid, ACS reagent, ≥99.0%
Sigma-Aldrich
Trichloroacetic acid, BioXtra, ≥99.0%
Sigma-Aldrich
Trichloroacetic acid, suitable for electrophoresis, suitable for fixing solution (for IEF and PAGE gels), ≥99%
Sigma-Aldrich
Ethanolamine, ≥98%
Sigma-Aldrich
Potassium chloride, for molecular biology, ≥99.0%
Sigma-Aldrich
Potassium chloride, powder, BioReagent, suitable for cell culture, suitable for insect cell culture, ≥99.0%
Sigma-Aldrich
Potassium chloride, BioXtra, ≥99.0%
Sigma-Aldrich
Ethanolamine, liquid, BioReagent, suitable for cell culture, ≥98%
Sigma-Aldrich
Potassium chloride solution, 0.075 M, sterile-filtered, BioXtra, suitable for cell culture
Sigma-Aldrich
11-Mercaptoundecanoic acid, 98%
Sigma-Aldrich
Acetone, suitable for HPLC, ≥99.9%