MilliporeSigma
Todas las fotos(1)

Documentos

EHU098801

Sigma-Aldrich

MISSION® esiRNA

targeting human MAN1A2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GATGCAGGGCCAGTTACAATAGTCCTTAAGAGAGTTAAATTATAGCACATGTTTTGACATTGTAATATCTTTTACTACTTGAACATTTAAATTTCTAAATGAGAAAGGTATATATATTACTGTAACTGTAGAAGGGAAAAGGGAAAGTATTTGGTTCTAAAAAATGTTAGCCTTCCTCGTAAAAGTAGCACAAGCCCACTTATGAATCACTGAGAAAAAGTGAAAAACTTGAGTTGGCAAAGATGCAG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Comparar elementos similares

Ver comparación completa

Mostrar Diferencias

1 of 4

Este artículo
EHU038791EHU022971EHU115841
MISSION® esiRNA targeting human MAN1A2

EHU098801

MISSION® esiRNA

MISSION® esiRNA targeting human TCERG1

EHU038791

MISSION® esiRNA

MISSION® esiRNA targeting human MPZL2

EHU022971

MISSION® esiRNA

MISSION® esiRNA targeting human PAIP1

EHU115841

MISSION® esiRNA

Gene Information

human ... MAN1A2(10905), MAN1A2(10905)

Gene Information

human ... TCERG1(10915), TCERG1(10915)

Gene Information

human ... MPZL2(10205), MPZL2(10205)

Gene Information

human ... PAIP1(10605), PAIP1(10605)

Ensembl | human accession no.

ENSG00000198162

Ensembl | human accession no.

ENSG00000113649

Ensembl | human accession no.

ENSG00000149573

Ensembl | human accession no.

ENSG00000172239

esiRNA cDNA target sequence

GATGCAGGGCCAGTTACAATAGTCCTTAAGAGAGTTAAATTATAGCACATGTTTTGACATTGTAATATCTTTTACTACTTGAACATTTAAATTTCTAAATGAGAAAGGTATATATATTACTGTAACTGTAGAAGGGAAAAGGGAAAGTATTTGGTTCTAAAAAATGTTAGCCTTCCTCGTAAAAGTAGCACAAGCCCACTTATGAATCACTGAGAAAAAGTGAAAAACTTGAGTTGGCAAAGATGCAG

esiRNA cDNA target sequence

CCAATTCCACTTCCAGGTGTAGCAATGATGCAAATAGTCAGCTGCCCGTATGTAAAGACAGTCGCTACCACCAAGACCGGTGTATTGCCAGGAATGGCCCCTCCTATCGTACCCATGATACATCCCCAGGTTGCTATTGCAGCTTCACCTGCTACCTTAGCTGGAGCAACAGCAGTTTCTGAATGGACTGAATATAAAACAGCAGATGGGAAGACATATTATTATAATAATAGAACATTAGAATCAACCTGGGAAAAACCCCAAGAACTAAAGGAAAAAGAAAAGTTAGAAGAGAAGATTAAAGAGCCAATTAAAGAACCCTCTGAAGAGCCTCTGCCAATGGAGACGGAGGAGGAGGATCCTAAAGAAGAGCCTATAAAGGAGATAAAGGAGGAGCCCAAAGAAGAG

esiRNA cDNA target sequence

GGGACAGATGCTCGGTTAAAATGCACTTTCTCCAGCTTTGCCCCTGTGGGTGATGCTCTAACAGTGACCTGGAATTTTCGTCCTCTAGACGGGGGACCTGAGCAGTTTGTATTCTACTACCACATAGATCCCTTCCAACCCATGAGTGGGCGGTTTAAGGACCGGGTGTCTTGGGATGGGAATCCTGAGCGGTACGATGCCTCCATCCTTCTCTGGAAACTGCAGTTCGACGACAATGGGACATACACCTGCCAGGTGAAGAACCCACCTGATGTTGATGGGGTGATAGGGGAGATCCGGCTCAGCGTCGTGCACACTGTACGCTTCTCTGAGATCCACTTCCTGGCTCTGGCCATTGGCTCTGCCTGTGCACTGATGATCATAATAGTAATTGTAGTGGTCCTCTTCCAGCATTACCGGAA

esiRNA cDNA target sequence

CCTATGAGGATGGTTGTGAGGATTATCCTACTCTATCAGAATATGTTCAGGATTTTTTGAATCATCTTACAGAGCAGCCTGGCAGTTTTGAAACTGAAATTGAACAGTTTGCAGAGACCCTGAATGGTTGTGTTACAACAGATGATGCTTTGCAAGAACTTGTGGAACTCATCTATCAACAGGCCACATCTATCCCAAATTTCTCTTATATGGGAGCTCGCCTGTGTAATTACCTGTCCCATCATCTGACAATTAGCCCACAGAGTGGCAACTTCCGCCAATTGCTACTTCAAAGATGTCGGACTGAATATGAAGTTAAAGATCAAGCTGCAAAAGGGGATGAAGTTACTCGAAAACGATTTCATGCATTTGTACTCTTTCTGGGAGAACTTTATCTTAACCTGGAGATCAAGGGAACAAATGGACAGG

NCBI accession no.

NM_006699

NCBI accession no.

NM_001040006

NCBI accession no.

NM_005797

NCBI accession no.

NM_183323

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Para su comodidad, los documentos relacionados con los productos que usted ha comprado con anterioridad se han recopilado en la Biblioteca de documentos.

Visite la Librería de documentos

¿Le resulta difícil encontrar su producto o lote/número de lote?

Las referencias de los producto se combinan con los tamaños de envase y las cantidades cuando se muestran en la página web, por ejemplo: T1503-25G. Asegúrese de introducir el número de producto ÚNICAMENTE en el campo del Número de producto (ejemplo: T1503).

Ejemplo

T1503
Referencia del producto
-
25G
Tamaño del envase/cantidad

Otros ejemplos

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

introducir como 1.000309185)

¿Tiene algún problema? No dude en ponerse en contacto con nosotros Servicio técnico para asistencia

Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch».

Productos Aldrich

  • Si encuentra un número de lote como TO09019TO, introduzca el número de lote 09019TO sin las dos primeras letras.

  • Si encuentra un número de lote con un código de entrada como 05427ES-021, introduzca el número 05427ES sin el código de entrada -021.

  • Si encuentra un número de lote con un código de entrada como STBB0728K9, introduzca el código de lote STBB0728 sin el código de entrada K9.

¿No ha encontrado lo que estaba buscando?

En algunos casos, puede que un COA no esté disponible en la página web. Si su búsqueda no encontró el COA puede solicitarlo.

Solicitar COA

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico