MilliporeSigma
Todas las fotos(1)

Documentos

EMU151601

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ensmusg00000073742

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTTGTTCTGTTTTACAATGCTTAGAAAATAAAGGAATGTATATGTTGTAGTTCTTATTGTGGTTGTCTAATTAAGACAACCCAATATCAACTAAAATAAATGAATAAATAAAAGAGCCGTAACACTAATATCCTCAGAGAATCTCCCAAACATGCATAACTCAGTCATTTTCATTGACTGGCTGGTGAACAACACACAAAAAAGGAGAATATCTGAGCCTTGCTCTCTTCCAGAGGCACATAGCCCAAGGAAGAAATACAGACTGACTGGGGTAGAAGTATTAAATATCCACACATGGCCTTACAACTGCTCAGTGCTGACAATATTTTTTTTAATTATTTTAAAAACTAACACAATGTTTCTTTGTTCACTGAATGATTTGTATATATATCCCCTTTATTCCTCTTCTATAGATTTTAGTATCTTCTTTCTTATCTATTTTATTCTCCTAATAACAAACTTCTATCTAGCATCTATCTATATATCTAACTAACTTTCATTTTATTTTGATTCTCAGT

shipped in

ambient

storage temp.

−20°C

Comparar elementos similares

Ver comparación completa

Mostrar Diferencias

1 of 4

Este artículo
EHNC011551EHU011811EHU098611
MISSION® esiRNA targeting mouse Ensmusg00000073742

EMU151601

MISSION® esiRNA

MISSION® esiRNA targeting human RP11-52J3.3

EHNC011551

MISSION® esiRNA

MISSION® esiRNA targeting human FAM162B

EHU011811

MISSION® esiRNA

MISSION® esiRNA targeting human IFT81

EHU098611

MISSION® esiRNA

product line

MISSION®

product line

MISSION®

product line

MISSION®

product line

MISSION®

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

form

lyophilized powder

description

Powered by Eupheria Biotech

description

-

description

Powered by Eupheria Biotech

description

Powered by Eupheria Biotech

shipped in

ambient

shipped in

ambient

shipped in

ambient

shipped in

ambient

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Para su comodidad, los documentos relacionados con los productos que usted ha comprado con anterioridad se han recopilado en la Biblioteca de documentos.

Visite la Librería de documentos

¿Le resulta difícil encontrar su producto o lote/número de lote?

Las referencias de los producto se combinan con los tamaños de envase y las cantidades cuando se muestran en la página web, por ejemplo: T1503-25G. Asegúrese de introducir el número de producto ÚNICAMENTE en el campo del Número de producto (ejemplo: T1503).

Ejemplo

T1503
Referencia del producto
-
25G
Tamaño del envase/cantidad

Otros ejemplos

705578-5MG-PW

PL860-CGA/SHF-1EA

MMYOMAG-74K-13

1000309185

introducir como 1.000309185)

¿Tiene algún problema? No dude en ponerse en contacto con nosotros Servicio técnico para asistencia

Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch».

Productos Aldrich

  • Si encuentra un número de lote como TO09019TO, introduzca el número de lote 09019TO sin las dos primeras letras.

  • Si encuentra un número de lote con un código de entrada como 05427ES-021, introduzca el número 05427ES sin el código de entrada -021.

  • Si encuentra un número de lote con un código de entrada como STBB0728K9, introduzca el código de lote STBB0728 sin el código de entrada K9.

¿No ha encontrado lo que estaba buscando?

En algunos casos, puede que un COA no esté disponible en la página web. Si su búsqueda no encontró el COA puede solicitarlo.

Solicitar COA

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico