Certificate Of Analysis
Product Name FLAG-tag Gene human,
MYF5
Product Number FTG224
Product Brand SIGMA
 
TEST SPECIFICATION LOT 103-257-1 RESULTS
Appearance turbid liquid Pass
Concentration 1.00E+06-1.00E+09 cells per ml Pass
Parent fosmid confirmation by PCR WI2-433M8 Pass
3xFLAG verification 3XFLAG tag plus two stop codons
(GACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCG
ACTACAAGGATGACGATGACAAGTGATAA)
inserted immediately 5' to the native stop codon
at the 3' end of coding sequence in parent fosmid.
Pass
Neo resistance verification by PCR Neo resistance gene inserted in the fosmid vector backbone Pass