Specification Sheet
Product Name FLAG-tag Gene human,
MYF5
Product Number FTG224
Product Brand SIGMA
 
TEST SPECIFICATION
Appearance turbid liquid
Concentration 1.00E+06-1.00E+09 cells per ml
Parent fosmid confirmation by PCR WI2-433M8
3xFLAG verification 3XFLAG tag plus two stop codons
(GACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCG
ACTACAAGGATGACGATGACAAGTGATAA)
inserted immediately 5' to the native stop codon
at the 3' end of coding sequence in parent fosmid.
Neo resistance verification by PCR Neo resistance gene inserted in the fosmid vector backbone