EMAIL THIS PAGE TO A FRIEND

A1CF

APOBEC1 complementation factor

120 Gene Product Result for
Synonyms: ACF ACF64 ACF65 APOBEC1CF ASP
Gene ID:
Human(29974) Summary: Mammalian apolipoprotein B mRNA undergoes site-specific C to U deamination, which is mediated by a multi-component enzyme complex containing a minimal core composed of APOBEC-1 and a complementation factor encoded by this gene. The gene product has three non-identical RNA recognition motifs and belongs to the hnRNP R family of RNA-binding proteins. It has been proposed that this complementation factor functions as an RNA-binding subunit and docks APOBEC-1 to deaminate the upstream cytidine. Studies suggest that the protein may also be involved in other RNA editing or RNA processing events. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Mouse(69865) APOBEC1 complementation factor
Rat(170912) APOBEC1 complementation factor
Zebrafish(562916) apobec1 complementation factor
cow(613704) APOBEC1 complementation factor
cow(100336715) APOBEC1 complementation factor
Horse(100071844) APOBEC1 complementation factor
domestic cat(101090646) APOBEC1 complementation factor
dog(477581) APOBEC1 complementation factor
chicken(423680) APOBEC1 complementation factor
sheep(101118147) APOBEC1 complementation factor
Domestic Rabbit(100339264) APOBEC1 complementation factor
domestic guinea pig(100730935) APOBEC1 complementation factor
naked mole-rat(101709076) APOBEC1 complementation factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138933 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138933 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138933 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081074 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081074 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081074 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU085321 MISSION® esiRNA esiRNA human A1CF (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014576 Rosetta Predictions human pricing
NM_138932 Rosetta Predictions human pricing
NM_138933 Rosetta Predictions human pricing
NM_133400 Rosetta Predictions rat pricing
NM_001081074 Rosetta Predictions mouse pricing
XM_001000199 Rosetta Predictions mouse pricing
XM_129159 Rosetta Predictions mouse pricing
XM_900652 Rosetta Predictions mouse pricing
XM_900657 Rosetta Predictions mouse pricing
XM_900663 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014576 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098767 predicted 909
2 SASI_Hs01_00098768 predicted 576
3 SASI_Hs01_00098769 predicted 575
4 SASI_Hs01_00098770 predicted 770
5 SASI_Hs01_00098771 predicted 582
6 SASI_Hs01_00098772 predicted 667
7 SASI_Hs01_00098773 predicted 740
8 SASI_Hs01_00098774 predicted 954
9 SASI_Hs01_00098775 predicted 687
10 SASI_Hs01_00098776 predicted 659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138932 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119437 predicted 903
2 SASI_Hs01_00119438 predicted 579
3 SASI_Hs01_00119439 predicted 576
4 SASI_Hs01_00119440 predicted 772
5 SASI_Hs01_00119441 predicted 582
6 SASI_Hs01_00119442 predicted 669
7 SASI_Hs01_00119443 predicted 740
8 SASI_Hs01_00119444 predicted 951
9 SASI_Hs01_00119445 predicted 691
10 SASI_Hs01_00119446 predicted 664
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138933 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112734 predicted 998
2 SASI_Hs01_00112735 predicted 673
3 SASI_Hs01_00112736 predicted 668
4 SASI_Hs01_00112737 predicted 867
5 SASI_Hs01_00112738 predicted 672
6 SASI_Hs01_00112739 predicted 765
7 SASI_Hs01_00112740 predicted 835
8 SASI_Hs01_00112741 predicted 1047
9 SASI_Hs01_00112742 predicted 784
10 SASI_Hs01_00112743 predicted 757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133400 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077605 predicted 545
2 SASI_Rn01_00077606 predicted 440
3 SASI_Rn01_00077607 predicted 427
4 SASI_Rn01_00077608 predicted 838
5 SASI_Rn01_00077609 predicted 1492
6 SASI_Rn01_00077610 predicted 429
7 SASI_Rn01_00077611 predicted 376
8 SASI_Rn02_00267658 predicted 406
9 SASI_Rn01_00077612 predicted 1366
10 SASI_Rn01_00077613 predicted 1401
11 SASI_Rn01_00077614 predicted 776
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081074 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294921 predicted 465
2 SASI_Mm02_00294922 predicted 485
3 SASI_Mm02_00294923 predicted 1942
4 SASI_Mm02_00294924 predicted 887
5 SASI_Mm02_00294925 predicted 920
6 SASI_Mm02_00294926 predicted 1230
7 SASI_Mm02_00294927 predicted 1649
8 SASI_Mm02_00294928 predicted 1955
9 SASI_Mm02_00294929 predicted 1805
10 SASI_Mm02_00294930 predicted 1994
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001000199 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00249010 predicted 898
2 SASI_Mm01_00249011 predicted 883
3 SASI_Mm01_00249012 predicted 800
4 SASI_Mm01_00249013 predicted 838
5 SASI_Mm01_00249014 predicted 973
6 SASI_Mm01_00249015 predicted 732
7 SASI_Mm01_00249016 predicted 751
8 SASI_Mm01_00249017 predicted 967
9 SASI_Mm01_00249018 predicted 773
10 SASI_Mm01_00249019 predicted 849
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_129159 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00268843 predicted 991
2 SASI_Mm01_00268844 predicted 973
3 SASI_Mm01_00268845 predicted 892
4 SASI_Mm01_00268846 predicted 929
5 SASI_Mm01_00268847 predicted 1052
6 SASI_Mm01_00268848 predicted 814
7 SASI_Mm01_00268849 predicted 844
8 SASI_Mm01_00268850 predicted 1047
9 SASI_Mm01_00268851 predicted 863
10 SASI_Mm01_00268852 predicted 928
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900652 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00238177 predicted 836
2 SASI_Mm01_00238178 predicted 808
3 SASI_Mm01_00238179 predicted 730
4 SASI_Mm01_00238180 predicted 766
5 SASI_Mm01_00238181 predicted 904
6 SASI_Mm01_00238182 predicted 668
7 SASI_Mm01_00238183 predicted 686
8 SASI_Mm01_00238184 predicted 894
9 SASI_Mm01_00238185 predicted 708
10 SASI_Mm01_00238186 predicted 781
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900657 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00222013 predicted 984
2 SASI_Mm01_00222014 predicted 966
3 SASI_Mm01_00222015 predicted 887
4 SASI_Mm01_00222016 predicted 925
5 SASI_Mm01_00222017 predicted 1054
6 SASI_Mm01_00222018 predicted 816
7 SASI_Mm01_00222019 predicted 840
8 SASI_Mm01_00222020 predicted 1050
9 SASI_Mm01_00222021 predicted 863
10 SASI_Mm01_00222022 predicted 930
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900663 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00281460 predicted 993
2 SASI_Mm01_00281461 predicted 970
3 SASI_Mm01_00281462 predicted 894
4 SASI_Mm01_00281463 predicted 931
5 SASI_Mm01_00281464 predicted 1052
6 SASI_Mm01_00281465 predicted 815
7 SASI_Mm01_00281466 predicted 845
8 SASI_Mm01_00281467 predicted 1057
9 SASI_Mm01_00281468 predicted 857
10 SASI_Mm01_00281469 predicted 938
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138933
VALIDATED
A1CF MISSION shRNA Bacterial Glycerol Stock
APOBEC1 complementation factor
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138933.1-1602s1c1
Sequence:CCGGCCCAGATATTAGAAGAGATTTCTCGAGAAATCTCTTCTAATATCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_138933.1-1245s1c1
Sequence:CCGGCCATGCTGCAAGGAGAGTATACTCGAGTATACTCTCCTTGCAGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138933.1-613s1c1
Sequence:CCGGGAATGCAATCAAGCAACTTAACTCGAGTTAAGTTGCTTGATTGCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138933.1-561s1c1
Sequence:CCGGGCAACAATAGAGGATATGCATCTCGAGATGCATATCCTCTATTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138933.1-1877s1c1
Sequence:CCGGGCTACTGCTTTCCCAGGATATCTCGAGATATCCTGGGAAAGCAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138933.1-1960s21c1
Sequence:CCGGACAAGACTTAGCAGCATATACCTCGAGGTATATGCTGCTAAGTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138933.1-679s21c1
Sequence:CCGGTGTGGACAACTGCCGATTATTCTCGAGAATAATCGGCAGTTGTCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138933.1-489s21c1
Sequence:CCGGAGGATGAGCTTATACCATTATCTCGAGATAATGGTATAAGCTCATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138933.1-613s21c1
Sequence:CCGGGAATGCAATCAAGCAACTTAACTCGAGTTAAGTTGCTTGATTGCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138933.1-1245s21c1
Sequence:CCGGCCATGCTGCAAGGAGAGTATACTCGAGTATACTCTCCTTGCAGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138933
VALIDATED
A1CF MISSION shRNA shRNA Plasmid DNA
APOBEC1 complementation factor
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138933.1-1602s1c1
Sequence:CCGGCCCAGATATTAGAAGAGATTTCTCGAGAAATCTCTTCTAATATCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_138933.1-1245s1c1
Sequence:CCGGCCATGCTGCAAGGAGAGTATACTCGAGTATACTCTCCTTGCAGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138933.1-613s1c1
Sequence:CCGGGAATGCAATCAAGCAACTTAACTCGAGTTAAGTTGCTTGATTGCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138933.1-561s1c1
Sequence:CCGGGCAACAATAGAGGATATGCATCTCGAGATGCATATCCTCTATTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138933.1-1877s1c1
Sequence:CCGGGCTACTGCTTTCCCAGGATATCTCGAGATATCCTGGGAAAGCAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138933.1-1960s21c1
Sequence:CCGGACAAGACTTAGCAGCATATACCTCGAGGTATATGCTGCTAAGTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138933.1-679s21c1
Sequence:CCGGTGTGGACAACTGCCGATTATTCTCGAGAATAATCGGCAGTTGTCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138933.1-489s21c1
Sequence:CCGGAGGATGAGCTTATACCATTATCTCGAGATAATGGTATAAGCTCATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138933.1-613s21c1
Sequence:CCGGGAATGCAATCAAGCAACTTAACTCGAGTTAAGTTGCTTGATTGCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138933.1-1245s21c1
Sequence:CCGGCCATGCTGCAAGGAGAGTATACTCGAGTATACTCTCCTTGCAGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138933
VALIDATED
A1CF MISSION shRNA Lentiviral Transduction Particles
APOBEC1 complementation factor
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138933.1-1602s1c1
Sequence:CCGGCCCAGATATTAGAAGAGATTTCTCGAGAAATCTCTTCTAATATCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_138933.1-1245s1c1
Sequence:CCGGCCATGCTGCAAGGAGAGTATACTCGAGTATACTCTCCTTGCAGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138933.1-613s1c1
Sequence:CCGGGAATGCAATCAAGCAACTTAACTCGAGTTAAGTTGCTTGATTGCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138933.1-561s1c1
Sequence:CCGGGCAACAATAGAGGATATGCATCTCGAGATGCATATCCTCTATTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138933.1-1877s1c1
Sequence:CCGGGCTACTGCTTTCCCAGGATATCTCGAGATATCCTGGGAAAGCAGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138933.1-1960s21c1
Sequence:CCGGACAAGACTTAGCAGCATATACCTCGAGGTATATGCTGCTAAGTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138933.1-679s21c1
Sequence:CCGGTGTGGACAACTGCCGATTATTCTCGAGAATAATCGGCAGTTGTCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138933.1-489s21c1
Sequence:CCGGAGGATGAGCTTATACCATTATCTCGAGATAATGGTATAAGCTCATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138933.1-613s21c1
Sequence:CCGGGAATGCAATCAAGCAACTTAACTCGAGTTAAGTTGCTTGATTGCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138933.1-1245s21c1
Sequence:CCGGCCATGCTGCAAGGAGAGTATACTCGAGTATACTCTCCTTGCAGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081074
A1CF MISSION shRNA Bacterial Glycerol Stock
APOBEC1 complementation factor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081074.1-1367s21c1
Sequence:CCGGGTCGAGGATACCACGTCAAAGCTCGAGCTTTGACGTGGTATCCTCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081074.1-841s21c1
Sequence:CCGGCTGTACGTAAGGAACCTTATGCTCGAGCATAAGGTTCCTTACGTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081074.1-1551s21c1
Sequence:CCGGTGCCATTGGACAAGATCAAAGCTCGAGCTTTGATCTTGTCCAATGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081074.1-2055s21c1
Sequence:CCGGCAAGATTTATTCGTCGTATTACTCGAGTAATACGACGAATAAATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081074.1-1848s21c1
Sequence:CCGGACAAGACTTAGCAGCATATACCTCGAGGTATATGCTGCTAAGTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081074
A1CF MISSION shRNA shRNA Plasmid DNA
APOBEC1 complementation factor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081074.1-1367s21c1
Sequence:CCGGGTCGAGGATACCACGTCAAAGCTCGAGCTTTGACGTGGTATCCTCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081074.1-841s21c1
Sequence:CCGGCTGTACGTAAGGAACCTTATGCTCGAGCATAAGGTTCCTTACGTACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081074.1-1551s21c1
Sequence:CCGGTGCCATTGGACAAGATCAAAGCTCGAGCTTTGATCTTGTCCAATGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081074.1-2055s21c1
Sequence:CCGGCAAGATTTATTCGTCGTATTACTCGAGTAATACGACGAATAAATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081074.1-1848s21c1
Sequence:CCGGACAAGACTTAGCAGCATATACCTCGAGGTATATGCTGCTAAGTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081074
A1CF MISSION shRNA Lentiviral Transduction Particles
APOBEC1 complementation factor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081074.1-1367s21c1
Sequence:CCGGGTCGAGGATACCACGTCAAAGCTCGAGCTTTGACGTGGTATCCTCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081074.1-841s21c1
Sequence:CCGGCTGTACGTAAGGAACCTTATGCTCGAGCATAAGGTTCCTTACGTACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081074.1-1551s21c1
Sequence:CCGGTGCCATTGGACAAGATCAAAGCTCGAGCTTTGATCTTGTCCAATGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081074.1-2055s21c1
Sequence:CCGGCAAGATTTATTCGTCGTATTACTCGAGTAATACGACGAATAAATCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081074.1-1848s21c1
Sequence:CCGGACAAGACTTAGCAGCATATACCTCGAGGTATATGCTGCTAAGTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)