EMAIL THIS PAGE TO A FRIEND

A230046K03Rik

21 Gene Product Result for
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033375 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033375 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033375 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU187501 MISSION® esiRNA targeting mouse Washc4 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033375 Rosetta Predictions mouse pricing
XM_985835 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033375 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288675 predicted 2610
2 SASI_Mm02_00288676 predicted 943
3 SASI_Mm02_00288677 predicted 2226
4 SASI_Mm02_00288678 predicted 558
5 SASI_Mm02_00288679 predicted 1520
6 SASI_Mm02_00288680 predicted 1273
7 SASI_Mm02_00288681 predicted 2209
8 SASI_Mm02_00288682 predicted 2122
9 SASI_Mm02_00288683 predicted 1785
10 SASI_Mm02_00288684 predicted 2911
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_985835 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00213846 predicted 2781
2 SASI_Mm01_00213847 predicted 1120
3 SASI_Mm01_00213848 predicted 2408
4 SASI_Mm01_00213849 predicted 730
5 SASI_Mm01_00213850 predicted 1033
6 SASI_Mm01_00213851 predicted 1691
7 SASI_Mm01_00213852 predicted 2380
8 SASI_Mm01_00213853 predicted 2291
9 SASI_Mm01_00213854 predicted 1950
10 SASI_Mm01_00213855 predicted 3091
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033375
VALIDATED
A230046K03Rik MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033375.2-1929s21c1
Sequence:CCGGCGCGCTGTCTTCCCGATTTATCTCGAGATAAATCGGGAAGACAGCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033375.2-2859s21c1
Sequence:CCGGGGTAATGCTATGGGCTATATACTCGAGTATATAGCCCATAGCATTACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033375.2-3119s21c1
Sequence:CCGGGAATATACATCTCCGAAATTTCTCGAGAAATTTCGGAGATGTATATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033375.2-3431s21c1
Sequence:CCGGGAAGCGACTGGAGGTCTATTTCTCGAGAAATAGACCTCCAGTCGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033375.2-4595s21c1
Sequence:CCGGGGTATGCTAGCTGATAGTTAACTCGAGTTAACTATCAGCTAGCATACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033375
VALIDATED
A230046K03Rik MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033375.2-1929s21c1
Sequence:CCGGCGCGCTGTCTTCCCGATTTATCTCGAGATAAATCGGGAAGACAGCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033375.2-2859s21c1
Sequence:CCGGGGTAATGCTATGGGCTATATACTCGAGTATATAGCCCATAGCATTACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033375.2-3119s21c1
Sequence:CCGGGAATATACATCTCCGAAATTTCTCGAGAAATTTCGGAGATGTATATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033375.2-3431s21c1
Sequence:CCGGGAAGCGACTGGAGGTCTATTTCTCGAGAAATAGACCTCCAGTCGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033375.2-4595s21c1
Sequence:CCGGGGTATGCTAGCTGATAGTTAACTCGAGTTAACTATCAGCTAGCATACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033375
VALIDATED
A230046K03Rik MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033375.2-1929s21c1
Sequence:CCGGCGCGCTGTCTTCCCGATTTATCTCGAGATAAATCGGGAAGACAGCGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000267752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033375.2-2859s21c1
Sequence:CCGGGGTAATGCTATGGGCTATATACTCGAGTATATAGCCCATAGCATTACCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000267751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033375.2-3119s21c1
Sequence:CCGGGAATATACATCTCCGAAATTTCTCGAGAAATTTCGGAGATGTATATTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000283540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033375.2-3431s21c1
Sequence:CCGGGAAGCGACTGGAGGTCTATTTCTCGAGAAATAGACCTCCAGTCGCTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000267694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033375.2-4595s21c1
Sequence:CCGGGGTATGCTAGCTGATAGTTAACTCGAGTTAACTATCAGCTAGCATACCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???