EMAIL THIS PAGE TO A FRIEND

A230050P20Rik

12 Gene Product Result for
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175687 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175687 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175687 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU008381 MISSION® esiRNA targeting mouse Shfl mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175687 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175687 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039618 predicted 589
2 SASI_Mm01_00039619 predicted 403
3 SASI_Mm01_00039620 predicted 690
4 SASI_Mm02_00346622 predicted 429
5 SASI_Mm01_00039621 predicted 671
6 SASI_Mm01_00039622 predicted 651
7 SASI_Mm01_00039623 predicted 316
8 SASI_Mm01_00039625 predicted 441
9 SASI_Mm01_00039626 predicted 738
10 SASI_Mm01_00039627 predicted 499
11 SASI_Mm01_00039624 predicted 670
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175687
VALIDATED
A230050P20Rik MISSION shRNA Bacterial Glycerol Stock
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175687.2-484s21c1
Sequence:CCGGCATGAAGCAAGACCAAGATATCTCGAGATATCTTGGTCTTGCTTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175687.1-1219s1c1
Sequence:CCGGCCGGGTCAACATAACAGCTTTCTCGAGAAAGCTGTTATGTTGACCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175687.2-399s21c1
Sequence:CCGGTTGGGCGCTCTATCGTGTATGCTCGAGCATACACGATAGAGCGCCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175687.2-536s21c1
Sequence:CCGGACGCAAGCCAATCTTCGAATGCTCGAGCATTCGAAGATTGGCTTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175687.2-891s21c1
Sequence:CCGGCAGCTGCAGATTGCTACAATCCTCGAGGATTGTAGCAATCTGCAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175687.1-842s1c1
Sequence:CCGGGCAGATTGCTACAATCGGAGACTCGAGTCTCCGATTGTAGCAATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175687.2-538s1c1
Sequence:CCGGGCAAGCCAATCTTCGAATGTTCTCGAGAACATTCGAAGATTGGCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189627    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175687.1-1300s1c1
Sequence:CCGGCCGGTAATGACCTCCATGATACTCGAGTATCATGGAGGTCATTACCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175687.2-610s21c1
Sequence:CCGGCTCCTCCTGTGACCATGTATGCTCGAGCATACATGGTCACAGGAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175687
VALIDATED
A230050P20Rik MISSION shRNA shRNA Plasmid DNA
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175687.2-484s21c1
Sequence:CCGGCATGAAGCAAGACCAAGATATCTCGAGATATCTTGGTCTTGCTTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175687.1-1219s1c1
Sequence:CCGGCCGGGTCAACATAACAGCTTTCTCGAGAAAGCTGTTATGTTGACCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175687.2-399s21c1
Sequence:CCGGTTGGGCGCTCTATCGTGTATGCTCGAGCATACACGATAGAGCGCCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175687.2-536s21c1
Sequence:CCGGACGCAAGCCAATCTTCGAATGCTCGAGCATTCGAAGATTGGCTTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175687.2-891s21c1
Sequence:CCGGCAGCTGCAGATTGCTACAATCCTCGAGGATTGTAGCAATCTGCAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175687.1-842s1c1
Sequence:CCGGGCAGATTGCTACAATCGGAGACTCGAGTCTCCGATTGTAGCAATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175687.2-538s1c1
Sequence:CCGGGCAAGCCAATCTTCGAATGTTCTCGAGAACATTCGAAGATTGGCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189627    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175687.1-1300s1c1
Sequence:CCGGCCGGTAATGACCTCCATGATACTCGAGTATCATGGAGGTCATTACCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175687.2-610s21c1
Sequence:CCGGCTCCTCCTGTGACCATGTATGCTCGAGCATACATGGTCACAGGAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175687
VALIDATED
A230050P20Rik MISSION shRNA Lentiviral Transduction Particles
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175687.2-484s21c1
Sequence:CCGGCATGAAGCAAGACCAAGATATCTCGAGATATCTTGGTCTTGCTTCATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000189489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175687.1-1219s1c1
Sequence:CCGGCCGGGTCAACATAACAGCTTTCTCGAGAAAGCTGTTATGTTGACCCGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000283102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175687.2-399s21c1
Sequence:CCGGTTGGGCGCTCTATCGTGTATGCTCGAGCATACACGATAGAGCGCCCAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000283104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175687.2-536s21c1
Sequence:CCGGACGCAAGCCAATCTTCGAATGCTCGAGCATTCGAAGATTGGCTTGCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000264627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175687.2-891s21c1
Sequence:CCGGCAGCTGCAGATTGCTACAATCCTCGAGGATTGTAGCAATCTGCAGCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000202435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175687.1-842s1c1
Sequence:CCGGGCAGATTGCTACAATCGGAGACTCGAGTCTCCGATTGTAGCAATCTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000217895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175687.2-538s1c1
Sequence:CCGGGCAAGCCAATCTTCGAATGTTCTCGAGAACATTCGAAGATTGGCTTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000189627    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175687.1-1300s1c1
Sequence:CCGGCCGGTAATGACCTCCATGATACTCGAGTATCATGGAGGTCATTACCGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000264629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175687.2-610s21c1
Sequence:CCGGCTCCTCCTGTGACCATGTATGCTCGAGCATACATGGTCACAGGAGGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???