EMAIL THIS PAGE TO A FRIEND

A330021E22Rik

13 Gene Product Result for
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172447 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172447 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172447 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU003441 MISSION® esiRNA targeting mouse Cfap69 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_172447 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172447 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095531 predicted 656
2 SASI_Mm02_00343955 predicted 1121
3 SASI_Mm01_00095534 predicted 335
4 SASI_Mm02_00343956 predicted 649
5 SASI_Mm01_00095535 predicted 455
6 SASI_Mm01_00095536 predicted 1574
7 SASI_Mm01_00095537 predicted 431
8 SASI_Mm01_00095538 predicted 1120
9 SASI_Mm01_00095539 predicted 2814
10 SASI_Mm01_00095540 predicted 426
11 SASI_Mm01_00095532 predicted 1202
12 SASI_Mm01_00095533 predicted 1823
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172447
A330021E22Rik MISSION shRNA Bacterial Glycerol Stock
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172447.2-459s1c1
Sequence:CCGGGAGATTTGGCACAGATATTTACTCGAGTAAATATCTGTGCCAAATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172447.1-1446s1c1
Sequence:CCGGGCACAGTATGAAGAACTACAACTCGAGTTGTAGTTCTTCATACTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172447.1-1805s1c1
Sequence:CCGGCCAGTCTGACACATTACTTATCTCGAGATAAGTAATGTGTCAGACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172447.1-1121s1c1
Sequence:CCGGGCGTCAGCTTAGAAATGATATCTCGAGATATCATTTCTAAGCTGACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172447.1-711s1c1
Sequence:CCGGGCAGAACCATTAAAGAAACATCTCGAGATGTTTCTTTAATGGTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172447.1-3036s1c1
Sequence:CCGGGTTCCACAGCTCCTGAAATAACTCGAGTTATTTCAGGAGCTGTGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172447.1-1183s1c1
Sequence:CCGGCGATGATTGAATGTGGCTTTACTCGAGTAAAGCCACATTCAATCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172447.1-2243s1c1
Sequence:CCGGCGGCAAGATTGTTGATACAAACTCGAGTTTGTATCAACAATCTTGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172447
A330021E22Rik MISSION shRNA shRNA Plasmid DNA
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172447.2-459s1c1
Sequence:CCGGGAGATTTGGCACAGATATTTACTCGAGTAAATATCTGTGCCAAATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172447.1-1446s1c1
Sequence:CCGGGCACAGTATGAAGAACTACAACTCGAGTTGTAGTTCTTCATACTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172447.1-1805s1c1
Sequence:CCGGCCAGTCTGACACATTACTTATCTCGAGATAAGTAATGTGTCAGACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172447.1-1121s1c1
Sequence:CCGGGCGTCAGCTTAGAAATGATATCTCGAGATATCATTTCTAAGCTGACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172447.1-711s1c1
Sequence:CCGGGCAGAACCATTAAAGAAACATCTCGAGATGTTTCTTTAATGGTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172447.1-3036s1c1
Sequence:CCGGGTTCCACAGCTCCTGAAATAACTCGAGTTATTTCAGGAGCTGTGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172447.1-1183s1c1
Sequence:CCGGCGATGATTGAATGTGGCTTTACTCGAGTAAAGCCACATTCAATCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172447.1-2243s1c1
Sequence:CCGGCGGCAAGATTGTTGATACAAACTCGAGTTTGTATCAACAATCTTGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172447
A330021E22Rik MISSION shRNA Lentiviral Transduction Particles
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172447.2-459s1c1
Sequence:CCGGGAGATTTGGCACAGATATTTACTCGAGTAAATATCTGTGCCAAATCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000174817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172447.1-1446s1c1
Sequence:CCGGGCACAGTATGAAGAACTACAACTCGAGTTGTAGTTCTTCATACTGTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000174442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172447.1-1805s1c1
Sequence:CCGGCCAGTCTGACACATTACTTATCTCGAGATAAGTAATGTGTCAGACTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000174932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172447.1-1121s1c1
Sequence:CCGGGCGTCAGCTTAGAAATGATATCTCGAGATATCATTTCTAAGCTGACGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000193614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172447.1-711s1c1
Sequence:CCGGGCAGAACCATTAAAGAAACATCTCGAGATGTTTCTTTAATGGTTCTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000175738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172447.1-3036s1c1
Sequence:CCGGGTTCCACAGCTCCTGAAATAACTCGAGTTATTTCAGGAGCTGTGGAACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000193406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172447.1-1183s1c1
Sequence:CCGGCGATGATTGAATGTGGCTTTACTCGAGTAAAGCCACATTCAATCATCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000193185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172447.1-2243s1c1
Sequence:CCGGCGGCAAGATTGTTGATACAAACTCGAGTTTGTATCAACAATCTTGCCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???