EMAIL THIS PAGE TO A FRIEND

A430078G23Rik

11 Gene Product Result for
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033378 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033378 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033378 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU175151 MISSION® esiRNA targeting mouse Arhgef18 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033378 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033378 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035038 predicted 460
2 SASI_Mm01_00035039 predicted 588
3 SASI_Mm01_00035040 predicted 311
4 SASI_Mm01_00035041 predicted 658
5 SASI_Mm01_00035042 predicted 505
6 SASI_Mm01_00035043 predicted 448
7 SASI_Mm01_00035044 predicted 347
8 SASI_Mm01_00035045 predicted 356
9 SASI_Mm01_00035046 predicted 442
10 SASI_Mm01_00035047 predicted 708
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033378
A430078G23Rik MISSION shRNA Bacterial Glycerol Stock
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000281698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033378.2-432s21c1
Sequence:CCGGAGAAGACTTCAGCCTGGATATCTCGAGATATCCAGGCTGAAGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033378.2-512s21c1
Sequence:CCGGTCCATCAGTCTGAAGTGATTACTCGAGTAATCACTTCAGACTGATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033378.2-475s21c1
Sequence:CCGGTACCTCCGGGATCTAGGCTTACTCGAGTAAGCCTAGATCCCGGAGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033378.2-351s21c1
Sequence:CCGGGAAACCTGAGAATCCAGATTTCTCGAGAAATCTGGATTCTCAGGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033378
A430078G23Rik MISSION shRNA shRNA Plasmid DNA
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000281698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033378.2-432s21c1
Sequence:CCGGAGAAGACTTCAGCCTGGATATCTCGAGATATCCAGGCTGAAGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033378.2-512s21c1
Sequence:CCGGTCCATCAGTCTGAAGTGATTACTCGAGTAATCACTTCAGACTGATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033378.2-475s21c1
Sequence:CCGGTACCTCCGGGATCTAGGCTTACTCGAGTAAGCCTAGATCCCGGAGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033378.2-351s21c1
Sequence:CCGGGAAACCTGAGAATCCAGATTTCTCGAGAAATCTGGATTCTCAGGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033378
A430078G23Rik MISSION shRNA Lentiviral Transduction Particles
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000281698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033378.2-432s21c1
Sequence:CCGGAGAAGACTTCAGCCTGGATATCTCGAGATATCCAGGCTGAAGTCTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000269160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033378.2-512s21c1
Sequence:CCGGTCCATCAGTCTGAAGTGATTACTCGAGTAATCACTTCAGACTGATGGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000269109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033378.2-475s21c1
Sequence:CCGGTACCTCCGGGATCTAGGCTTACTCGAGTAAGCCTAGATCCCGGAGGTATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000269110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033378.2-351s21c1
Sequence:CCGGGAAACCTGAGAATCCAGATTTCTCGAGAAATCTGGATTCTCAGGTTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???