EMAIL THIS PAGE TO A FRIEND

A430093F15Rik

21 Gene Product Result for
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207529 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207529 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207529 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU158281 MISSION® esiRNA targeting mouse A430093f15rik mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207529 Rosetta Predictions mouse pricing
XR_035341 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207529 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149653 predicted 1874
2 SASI_Mm01_00149654 predicted 1860
3 SASI_Mm01_00149655 predicted 1839
4 SASI_Mm01_00149656 predicted 1450
5 SASI_Mm01_00149657 predicted 1857
6 SASI_Mm01_00149658 predicted 1860
7 SASI_Mm01_00149659 predicted 1385
8 SASI_Mm01_00149660 predicted 1745
9 SASI_Mm01_00149661 predicted 1604
10 SASI_Mm01_00149662 predicted 1835
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_035341 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00481795 predicted 740
2 SASI_Mm02_00481796 predicted 730
3 SASI_Mm02_00481797 predicted 703
4 SASI_Mm02_00481798 predicted 321
5 SASI_Mm02_00481799 predicted 733
6 SASI_Mm02_00481800 predicted 735
7 SASI_Mm02_00481801 predicted 228
8 SASI_Mm02_00481802 predicted 477
9 SASI_Mm02_00481803 predicted 703
10 SASI_Mm02_00481804 predicted 681
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207529
A430093F15Rik MISSION shRNA Bacterial Glycerol Stock
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207529.1-1539s1c1
Sequence:CCGGCAGGAATGTGGGATTCAGAGACTCGAGTCTCTGAATCCCACATTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193004    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207529.1-1873s1c1
Sequence:CCGGGCATGAAACTTGACCCTGATTCTCGAGAATCAGGGTCAAGTTTCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207529.1-1604s1c1
Sequence:CCGGCAAGGACACAGTCCCTATCTTCTCGAGAAGATAGGGACTGTGTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207529.1-1472s1c1
Sequence:CCGGCAAAGCTCAGTTTCCTTGGATCTCGAGATCCAAGGAAACTGAGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207529
A430093F15Rik MISSION shRNA shRNA Plasmid DNA
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207529.1-1539s1c1
Sequence:CCGGCAGGAATGTGGGATTCAGAGACTCGAGTCTCTGAATCCCACATTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193004    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207529.1-1873s1c1
Sequence:CCGGGCATGAAACTTGACCCTGATTCTCGAGAATCAGGGTCAAGTTTCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207529.1-1604s1c1
Sequence:CCGGCAAGGACACAGTCCCTATCTTCTCGAGAAGATAGGGACTGTGTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207529.1-1472s1c1
Sequence:CCGGCAAAGCTCAGTTTCCTTGGATCTCGAGATCCAAGGAAACTGAGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207529
A430093F15Rik MISSION shRNA Lentiviral Transduction Particles
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207529.1-1539s1c1
Sequence:CCGGCAGGAATGTGGGATTCAGAGACTCGAGTCTCTGAATCCCACATTCCTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000193004    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207529.1-1873s1c1
Sequence:CCGGGCATGAAACTTGACCCTGATTCTCGAGAATCAGGGTCAAGTTTCATGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000190286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207529.1-1604s1c1
Sequence:CCGGCAAGGACACAGTCCCTATCTTCTCGAGAAGATAGGGACTGTGTCCTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000192118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207529.1-1472s1c1
Sequence:CCGGCAAAGCTCAGTTTCCTTGGATCTCGAGATCCAAGGAAACTGAGCTTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???